ID: 1007686091

View in Genome Browser
Species Human (GRCh38)
Location 6:43668160-43668182
Sequence GGCTTTTCCCCGAGTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007686085_1007686091 0 Left 1007686085 6:43668137-43668159 CCTGCAGCACCAAGTCTGCAGGG 0: 1
1: 0
2: 1
3: 28
4: 245
Right 1007686091 6:43668160-43668182 GGCTTTTCCCCGAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1007686089_1007686091 -9 Left 1007686089 6:43668146-43668168 CCAAGTCTGCAGGGGGCTTTTCC 0: 1
1: 0
2: 1
3: 13
4: 215
Right 1007686091 6:43668160-43668182 GGCTTTTCCCCGAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007686091 Original CRISPR GGCTTTTCCCCGAGTCCTGG AGG Intronic
900363647 1:2301678-2301700 GTCTTCTCCTAGAGTCCTGGAGG + Intronic
900425418 1:2576194-2576216 GCATTTTCCCACAGTCCTGGTGG + Intergenic
900641526 1:3690083-3690105 GGCTTGTCCCTGTTTCCTGGGGG + Intronic
901794311 1:11671747-11671769 GGCTTTTCCTCCAGTGCAGGAGG - Intronic
902332651 1:15738164-15738186 GGCTGTGCCCCGAGTCATGGTGG + Exonic
903061243 1:20670355-20670377 GGCTTTGCCCCCAGTGCTGTGGG - Intronic
904910223 1:33929102-33929124 GGCTTTTCCTGGAGGGCTGGTGG - Intronic
906648257 1:47491654-47491676 GGCCTTTCCCTGATTCCCGGGGG - Intergenic
907661001 1:56392310-56392332 GGGTGTTCCACGAGTCCTTGGGG + Intergenic
910899210 1:92101496-92101518 GGAGGTTCCCCGGGTCCTGGTGG - Intronic
911485778 1:98503024-98503046 GGCTTTCACCAGTGTCCTGGTGG - Intergenic
911522790 1:98948406-98948428 GTCTTTTCCCAGAATACTGGTGG - Intronic
912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG + Exonic
913448632 1:118976382-118976404 GATTTTTCCCAGAATCCTGGGGG + Intronic
915812149 1:158924484-158924506 GGCATTTCCCCCAGTTCTGGAGG - Intergenic
922771235 1:228184305-228184327 TGATTTTCCCACAGTCCTGGAGG - Intergenic
1062840474 10:666515-666537 GGCTGCTCCCGGAGTCCTGCAGG - Intronic
1062910352 10:1208292-1208314 GGATGTTCCCCCAGTTCTGGAGG + Intronic
1064970296 10:21059131-21059153 GGCTTCACCCCGACTGCTGGGGG - Intronic
1066560216 10:36661881-36661903 AGATTTTGCCTGAGTCCTGGAGG + Intergenic
1069782232 10:70964238-70964260 GGCTCTGCCCCGGGCCCTGGTGG - Intergenic
1073074759 10:100816850-100816872 GGCTGTTCTCCGAGCCCTGCAGG - Intronic
1073433540 10:103502322-103502344 GCATTTTCTCAGAGTCCTGGAGG + Intronic
1075739479 10:124685597-124685619 CGGGTTTCCCCGAGGCCTGGCGG - Intronic
1076427056 10:130374277-130374299 GGCGTTTCCCCTAGTCCTGTTGG - Intergenic
1076646176 10:131956398-131956420 GGCCTTCCTCCGAGTCCAGGTGG + Exonic
1080388614 11:31824987-31825009 GGCTTTTCCCTGAGTTCTCTGGG + Intronic
1080586523 11:33687872-33687894 GGCCTTTCCCAGAGGCCTGCAGG - Intergenic
1080683377 11:34496141-34496163 GGCGTTTCTCCGAATCCTTGAGG - Intronic
1081575400 11:44316109-44316131 AGCTTTTCTGCGAGCCCTGGAGG - Intergenic
1081635419 11:44718351-44718373 GGCTTTTCCCAGAGTCTCAGAGG - Intergenic
1081930275 11:46865246-46865268 GGCCTTTCCCCCTTTCCTGGAGG - Intronic
1090722531 11:129489592-129489614 GCTTTTTCCCAGAGTCCTGGTGG + Intergenic
1091202636 11:133793839-133793861 TGCCTTTCTCTGAGTCCTGGGGG - Intergenic
1098108492 12:67096232-67096254 GGCTTTTTCCCAAGGCCTGGTGG + Intergenic
1101373750 12:104153069-104153091 GGCTTTTTCCCCAGGACTGGTGG - Intergenic
1102435684 12:112921560-112921582 GGCTTACTCCAGAGTCCTGGAGG + Intronic
1103311771 12:120015401-120015423 GGAATTTCCCCCAGTCCTGAAGG + Intronic
1113873854 13:113582577-113582599 GACTTCTCCCTGAGACCTGGGGG - Intergenic
1113969714 13:114179491-114179513 TGCTTTCCCTGGAGTCCTGGAGG + Intergenic
1113988995 13:114343797-114343819 GGCTTTTCTCAGAGTGCTGTTGG + Intergenic
1114866070 14:26597352-26597374 GCCTTTTCCGCGAGTCCGGCGGG + Exonic
1119480446 14:74954975-74954997 GGCTGTCCCCCAGGTCCTGGGGG - Intronic
1119831583 14:77707766-77707788 CGCTTTGCCCCGCGTCTTGGAGG - Intronic
1121098519 14:91234057-91234079 CGCTTTTCCCGGAGGCCTCGGGG + Exonic
1121876523 14:97458129-97458151 GGGTCTTCCCCGCTTCCTGGTGG + Intergenic
1123755545 15:23395089-23395111 GGCTTTTGCCCTAGTTTTGGAGG + Intergenic
1130164812 15:81443405-81443427 GGCTTTGCCCTGACTCCTGGAGG - Intergenic
1130582614 15:85152163-85152185 AGCTCTTCTCCCAGTCCTGGAGG - Intergenic
1130787684 15:87118368-87118390 AGCTTTTCCCCATGTTCTGGCGG + Intergenic
1131842712 15:96454399-96454421 TGCTTTTCTCAGAGTCTTGGAGG + Intergenic
1134269845 16:12723868-12723890 AGCTTTTCCCCGTGTGGTGGAGG - Intronic
1134460831 16:14427937-14427959 GGCTTTTGCCCTAGTTTTGGAGG - Intergenic
1135611584 16:23872207-23872229 TGCTTTTCCCTGAGTCCATGTGG + Intronic
1136029245 16:27490813-27490835 CGCTTTTCCCCTCATCCTGGGGG + Intronic
1137753177 16:50881570-50881592 GCATTTTCTCAGAGTCCTGGAGG + Intergenic
1140491806 16:75343366-75343388 GGCTGTTCCACGACTCCTTGAGG - Intronic
1141551182 16:84807684-84807706 GCATTTTCCCACAGTCCTGGAGG - Intergenic
1143029680 17:3960958-3960980 GGCTTTTCTCTGACTTCTGGTGG - Intronic
1145269605 17:21397717-21397739 GTCCTTTCCCAGAGTCGTGGGGG - Intronic
1146694468 17:34898116-34898138 GGCTCCTCTCCCAGTCCTGGTGG - Intergenic
1147159378 17:38561589-38561611 GTCTTTGCCGAGAGTCCTGGAGG - Exonic
1150248247 17:63691726-63691748 GGTCTTTCACCGAGCCCTGGAGG - Exonic
1152624336 17:81381364-81381386 CTATTTTCTCCGAGTCCTGGTGG + Intergenic
1155579661 18:27288581-27288603 GGATTTTCCCATAGTTCTGGAGG - Intergenic
1157106941 18:44782704-44782726 TGCTTTTCCAGGAATCCTGGGGG + Intronic
1160633107 18:80260374-80260396 GGCTTTTCTCAGAGTGCTGTTGG + Intergenic
1161301399 19:3544631-3544653 GGCTTTTCCCCAAGGCCCTGGGG + Exonic
1163210774 19:15838547-15838569 GGAATTTCCCCTAGTCCAGGAGG - Intergenic
1166760379 19:45220702-45220724 GGCTTCTCCCCAAGCCCAGGAGG - Intronic
925163423 2:1702340-1702362 GGCTATTCCCTGCGTCCTGGAGG - Intronic
925316516 2:2930695-2930717 GGCTTTACCCTGAGTTCAGGTGG - Intergenic
931379884 2:61742880-61742902 GGCTTTTTCCAGGGTCTTGGAGG + Intergenic
931483769 2:62669927-62669949 AACTTTTCCACTAGTCCTGGTGG + Intergenic
932285000 2:70524678-70524700 TGATTTTCCCAGAGTCCAGGAGG + Intronic
933724560 2:85419105-85419127 GGCTTCACCACGAGTCCTGCCGG - Intronic
936371529 2:111905858-111905880 GGATTTTCCATGAGTCTTGGAGG + Intronic
938314174 2:130315009-130315031 GGCTGTTCCCCGTGCCCTAGTGG + Intergenic
946054769 2:216891106-216891128 GGCTTTGCCCAGTTTCCTGGTGG - Intergenic
946073146 2:217051592-217051614 GGCTTTTCCCCAATTCCCTGAGG + Intergenic
946432104 2:219631474-219631496 GGCCTTTCCCCGACTGCTGCTGG + Intronic
947271422 2:228340567-228340589 GGCTTTTACCTGAGTAATGGGGG - Intergenic
947499886 2:230664265-230664287 GGCTCTCCTCCCAGTCCTGGGGG - Intergenic
948570684 2:238915375-238915397 GGATTCTCCCAGAGTTCTGGGGG - Intergenic
948797497 2:240412408-240412430 AGCTTGTCCCCAAGCCCTGGAGG + Intergenic
1169067848 20:2704597-2704619 GGCTTTCCCCTAAGTCCTTGAGG - Intronic
1170615026 20:17941487-17941509 GGTTCTGCCCAGAGTCCTGGGGG - Intergenic
1171091385 20:22288638-22288660 GGCTTCTCCCCTAGTACTGGAGG - Intergenic
1171142607 20:22755920-22755942 GGCTTTACCCTGATCCCTGGGGG + Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175451487 20:59072491-59072513 GGATTCTCCCCTAGTTCTGGAGG - Intergenic
1179133802 21:38661582-38661604 GGCTTAGCCCCGAGCCCCGGAGG - Intronic
1179262694 21:39772449-39772471 GGATTTTCTCACAGTCCTGGAGG + Intronic
1179550691 21:42141751-42141773 AGATGTTCCCAGAGTCCTGGTGG + Intronic
1180124378 21:45778989-45779011 GGCTTGCCCCCCAGCCCTGGTGG + Intronic
1180839804 22:18954083-18954105 GGCCTCTCCCCGAGCTCTGGCGG + Intergenic
1181062091 22:20286396-20286418 GGCCTCTCCCCGAGCTCTGGCGG - Intergenic
1183736054 22:39645577-39645599 GGATTTTCCCAGAGTCCTCTGGG + Intronic
1184321762 22:43747366-43747388 TGCTGTTCCCCTAGTCCTTGAGG - Intronic
1185139450 22:49092226-49092248 GGAATTTCCTGGAGTCCTGGAGG + Intergenic
949985504 3:9537580-9537602 GGCTTTTCACCAAATCCTAGAGG - Intronic
950662588 3:14475872-14475894 GTCTTTTCCCTTATTCCTGGTGG + Intronic
951611057 3:24494063-24494085 GGCTTCTCTCCGCCTCCTGGGGG - Intronic
952692996 3:36231877-36231899 GGCTTTTCCTTGAGGCCTGTGGG - Intergenic
953556005 3:43947561-43947583 GGCCTTGCCCAGACTCCTGGAGG - Intergenic
954576754 3:51680594-51680616 GTCTTTACCCCGAGTGGTGGTGG + Intronic
955811942 3:62800106-62800128 CCCTGTTCCCCAAGTCCTGGGGG - Intronic
956060711 3:65345283-65345305 GGATTTTCTCAGAGTTCTGGAGG - Intergenic
957079807 3:75627502-75627524 GGCTTTTCTCAGAGTGCTGTTGG - Intergenic
958582000 3:96038923-96038945 AGCTTTTCTCAGAGTTCTGGAGG + Intergenic
961529793 3:127533485-127533507 GACTTTTCCCCAGGTCCTGCAGG - Intergenic
963188615 3:142444396-142444418 GGCTCTTCTCCAACTCCTGGTGG - Intronic
964794327 3:160481053-160481075 GGCTTTCCTCTGACTCCTGGTGG + Intronic
964801650 3:160565097-160565119 CGCCATTCCCCGAGGCCTGGAGG + Intronic
965766734 3:172138169-172138191 GACTTTTCCCTGAATTCTGGAGG + Intronic
965866752 3:173214625-173214647 GGCTTTTCCCCAATTCCCTGGGG - Intergenic
967310370 3:188100394-188100416 GGCTGGTCTCCGACTCCTGGTGG - Intergenic
968373451 4:16910-16932 GGCTTTTCTCAGAGTGCTGTTGG - Intergenic
981183685 4:141776031-141776053 GGCTTTTCCCCCAGTTGTGTGGG + Intergenic
983178796 4:164623272-164623294 GGCTTGCCCCCTAGCCCTGGTGG - Intergenic
985461945 4:190115644-190115666 GGCTTTTCTCAGAGTGCTGTTGG + Intergenic
985467937 5:15214-15236 GGCTTTTCTCAGAGTGCTGTTGG - Intergenic
985568104 5:630390-630412 GGATTTGACCCAAGTCCTGGTGG + Intronic
990137813 5:52668583-52668605 GGCTTTCTCCCCAGTCCTGCAGG - Intergenic
992145735 5:73845705-73845727 GTCTTTTGCCCCAGTCGTGGTGG + Intronic
994184177 5:96800048-96800070 GGCTTTGCCTAGAGTCCTGAGGG - Intronic
995809054 5:116084888-116084910 GACTTGTCCCGCAGTCCTGGAGG - Intergenic
997396462 5:133563975-133563997 GGATTTTCTCCCAGTTCTGGAGG + Intronic
998265066 5:140661825-140661847 AGGTTTTCCCAGAGTCCTGTGGG - Intronic
1000571743 5:162923654-162923676 TGCTTTTCTCAGAGTGCTGGTGG - Intergenic
1001254984 5:170176568-170176590 GGCTTTTTCTGGAGTGCTGGCGG + Intergenic
1007555920 6:42766262-42766284 GGCTTTTCCACAAATCTTGGGGG + Intronic
1007686091 6:43668160-43668182 GGCTTTTCCCCGAGTCCTGGAGG + Intronic
1007771070 6:44192704-44192726 AGCTTTAACCCGAGGCCTGGAGG - Intergenic
1013624045 6:111919560-111919582 GTATTTTCCCACAGTCCTGGTGG - Intergenic
1014830156 6:126093629-126093651 ATATTTTCCCCCAGTCCTGGAGG + Intergenic
1017723201 6:157258740-157258762 GGGTTTTCCCAGCTTCCTGGTGG + Intergenic
1019168763 6:170116962-170116984 GCCTTTCCTCAGAGTCCTGGCGG - Intergenic
1020069217 7:5214746-5214768 GGCTTGTCCCAGAGTGCTGGAGG - Intronic
1024332382 7:48169194-48169216 GGCATTTTCCCCAGTCCTAGTGG + Intergenic
1024903885 7:54353968-54353990 GGCTTTTCCCTGAATCCAGAGGG + Intergenic
1025095313 7:56091748-56091770 GGCTGTTCCAGGAATCCTGGTGG + Intronic
1033597615 7:142868234-142868256 TACTTCACCCCGAGTCCTGGAGG - Exonic
1034980582 7:155473553-155473575 GTCTATTCTCCGAGTCCTGGAGG + Intergenic
1035513877 8:215054-215076 GGCTTTTCTCAGAGTGCTGTTGG - Intergenic
1035865357 8:3076160-3076182 GGATTTTCTCACAGTCCTGGAGG + Intronic
1038432786 8:27513361-27513383 GGCTTTTCGCCCAGGGCTGGGGG + Intronic
1041015193 8:53586052-53586074 GGCTGTTCCCCTAGTGCTGCAGG - Intergenic
1043150223 8:76705862-76705884 GGCTTTACCCCGAGTACTCCTGG + Exonic
1049989705 9:979058-979080 GGCCTCTGCCCTAGTCCTGGGGG - Intronic
1060308952 9:122442021-122442043 GGCTTTTCCCAGAGTGTTGATGG - Intergenic
1060415359 9:123426021-123426043 GGCACTTCACAGAGTCCTGGAGG + Intronic
1062025613 9:134338862-134338884 GGCTGTCTCCAGAGTCCTGGAGG - Intronic
1062049986 9:134442311-134442333 GGCTGTGCCCAGAGTCCAGGGGG - Intergenic
1185609908 X:1388015-1388037 TGATTCTCCCGGAGTCCTGGAGG - Intronic
1190380522 X:49836495-49836517 GTCCAGTCCCCGAGTCCTGGTGG - Intergenic
1196110453 X:111941531-111941553 GGCATTTCCACCAGTCGTGGAGG + Intronic
1200076250 X:153552702-153552724 GGATTCTCCCCCAGTTCTGGAGG + Intronic
1200120313 X:153787117-153787139 GGCTTTTCCTCCAGTGCTGCAGG - Exonic