ID: 1007686092

View in Genome Browser
Species Human (GRCh38)
Location 6:43668163-43668185
Sequence TTTTCCCCGAGTCCTGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007686089_1007686092 -6 Left 1007686089 6:43668146-43668168 CCAAGTCTGCAGGGGGCTTTTCC No data
Right 1007686092 6:43668163-43668185 TTTTCCCCGAGTCCTGGAGGCGG 0: 1
1: 0
2: 1
3: 16
4: 183
1007686085_1007686092 3 Left 1007686085 6:43668137-43668159 CCTGCAGCACCAAGTCTGCAGGG No data
Right 1007686092 6:43668163-43668185 TTTTCCCCGAGTCCTGGAGGCGG 0: 1
1: 0
2: 1
3: 16
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007686092 Original CRISPR TTTTCCCCGAGTCCTGGAGG CGG Intronic