ID: 1007686097

View in Genome Browser
Species Human (GRCh38)
Location 6:43668176-43668198
Sequence CTGGAGGCGGTGACAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007686089_1007686097 7 Left 1007686089 6:43668146-43668168 CCAAGTCTGCAGGGGGCTTTTCC No data
Right 1007686097 6:43668176-43668198 CTGGAGGCGGTGACAGCAGCTGG No data
1007686085_1007686097 16 Left 1007686085 6:43668137-43668159 CCTGCAGCACCAAGTCTGCAGGG No data
Right 1007686097 6:43668176-43668198 CTGGAGGCGGTGACAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007686097 Original CRISPR CTGGAGGCGGTGACAGCAGC TGG Intronic