ID: 1007686098

View in Genome Browser
Species Human (GRCh38)
Location 6:43668180-43668202
Sequence AGGCGGTGACAGCAGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 438}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007686093_1007686098 -10 Left 1007686093 6:43668167-43668189 CCCCGAGTCCTGGAGGCGGTGAC 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1007686098 6:43668180-43668202 AGGCGGTGACAGCAGCTGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 438
1007686089_1007686098 11 Left 1007686089 6:43668146-43668168 CCAAGTCTGCAGGGGGCTTTTCC No data
Right 1007686098 6:43668180-43668202 AGGCGGTGACAGCAGCTGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 438
1007686085_1007686098 20 Left 1007686085 6:43668137-43668159 CCTGCAGCACCAAGTCTGCAGGG No data
Right 1007686098 6:43668180-43668202 AGGCGGTGACAGCAGCTGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007686098 Original CRISPR AGGCGGTGACAGCAGCTGGC TGG Intronic