ID: 1007686099

View in Genome Browser
Species Human (GRCh38)
Location 6:43668181-43668203
Sequence GGCGGTGACAGCAGCTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007686089_1007686099 12 Left 1007686089 6:43668146-43668168 CCAAGTCTGCAGGGGGCTTTTCC No data
Right 1007686099 6:43668181-43668203 GGCGGTGACAGCAGCTGGCTGGG No data
1007686085_1007686099 21 Left 1007686085 6:43668137-43668159 CCTGCAGCACCAAGTCTGCAGGG No data
Right 1007686099 6:43668181-43668203 GGCGGTGACAGCAGCTGGCTGGG No data
1007686093_1007686099 -9 Left 1007686093 6:43668167-43668189 CCCCGAGTCCTGGAGGCGGTGAC 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1007686099 6:43668181-43668203 GGCGGTGACAGCAGCTGGCTGGG No data
1007686094_1007686099 -10 Left 1007686094 6:43668168-43668190 CCCGAGTCCTGGAGGCGGTGACA No data
Right 1007686099 6:43668181-43668203 GGCGGTGACAGCAGCTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007686099 Original CRISPR GGCGGTGACAGCAGCTGGCT GGG Intronic