ID: 1007688652

View in Genome Browser
Species Human (GRCh38)
Location 6:43683146-43683168
Sequence TGGGCTTTGATCTGTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 438}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007688652 Original CRISPR TGGGCTTTGATCTGTTTTCC AGG (reversed) Intronic
901229455 1:7633769-7633791 TCGGGTTTGGCCTGTTTTCCTGG - Intronic
901251393 1:7783284-7783306 AGGGTTTTGCTCTGTTGTCCAGG - Intergenic
901897407 1:12326355-12326377 TGGGTTTTGCTCTGTTACCCAGG + Intronic
902646268 1:17800784-17800806 TGGGTTTTGATATGTTGGCCAGG + Intronic
903124094 1:21236048-21236070 TGGGCTTTCATGTCTTTTTCTGG + Intronic
903169667 1:21544289-21544311 TGGGCTTGGATCAGATTTGCTGG + Intronic
903423543 1:23236221-23236243 TGGGTTTTGCTCTGTTGCCCAGG + Intergenic
904130453 1:28271922-28271944 TGTCCTTTGATCTCTTTTCTGGG + Intronic
904511542 1:31014107-31014129 TGGGCTGTCACATGTTTTCCAGG - Intronic
905208847 1:36359378-36359400 AGGGCTTTGTTCTGTTGCCCTGG - Intronic
905730510 1:40296098-40296120 TGGGCTCTTCTCTGTTATCCAGG + Intergenic
906259955 1:44379355-44379377 TGGGCTTTGATCTCTCTGCCTGG - Intergenic
906316621 1:44790543-44790565 TGGTCTATGATCTGTTTACAGGG + Intergenic
912608806 1:111021379-111021401 AGGGCTTTGTTATGTTGTCCAGG - Intergenic
914411711 1:147435506-147435528 TGGCTTTTCATCTGTGTTCCAGG + Intergenic
915407151 1:155669057-155669079 AGGGTTTTGCTCTGTTGTCCAGG + Intronic
915529305 1:156494236-156494258 TGGGGCTTGGTCTCTTTTCCTGG - Intronic
916164197 1:161950431-161950453 TGGTCCTTAATCTGTTTTCAGGG + Intronic
916281589 1:163057579-163057601 TGGGCTTTGATTGTTTTTGCAGG - Intergenic
917104544 1:171479116-171479138 AGAGTTTTGCTCTGTTTTCCAGG + Intergenic
917589564 1:176462431-176462453 AGGGTTTTGCTCTGTCTTCCAGG + Intergenic
918604288 1:186402784-186402806 GGGGCTTTGTTATGTTGTCCAGG + Intronic
918737088 1:188078317-188078339 AGGGTTTTGCTCTGTTTCCCAGG - Intergenic
920215031 1:204356539-204356561 AGGGCCTTGTTCTGTTGTCCAGG - Intronic
921174954 1:212585515-212585537 GGGGCTTGCCTCTGTTTTCCCGG + Intronic
921615267 1:217258904-217258926 GGGGTTTTGCTCTGTTGTCCAGG - Intergenic
922399914 1:225242206-225242228 TGGGTCTTAATCTGTTTCCCAGG - Intronic
922774786 1:228209641-228209663 TGGGCCTTGCTCTGTTGCCCAGG + Intronic
923882987 1:238124141-238124163 AGGGTTTTTTTCTGTTTTCCAGG + Intergenic
1062826395 10:571835-571857 TGGGCCTTGCTCTGGTTTGCTGG - Intronic
1064193063 10:13224299-13224321 TGGGTTTTGCTCTGTTACCCAGG - Intronic
1064413731 10:15130676-15130698 AGGGCCTTGCTCTGTTGTCCAGG - Intronic
1065005884 10:21379720-21379742 AGGGTCTTGCTCTGTTTTCCAGG - Intergenic
1065219066 10:23477426-23477448 TGGGTTTTGATATGTTGCCCAGG + Intergenic
1065481878 10:26203311-26203333 TGAGTTTTTATCTGTTTTCTTGG + Intronic
1065996763 10:31066700-31066722 GGGGTCTTGCTCTGTTTTCCAGG + Intergenic
1066296916 10:34061996-34062018 TGGGCTTTGTTCTGTGTCACTGG + Intergenic
1066383902 10:34925553-34925575 TGGGTTTTGCTCTGTTGCCCAGG - Intergenic
1066423578 10:35284229-35284251 CAGGCTTTGAACTTTTTTCCAGG + Intronic
1066430491 10:35346654-35346676 TGGGTTTTGTTCTGTTGCCCAGG + Intronic
1067397344 10:45934163-45934185 AGGGCTTTGCTCTGTCCTCCAGG - Intergenic
1067865665 10:49903250-49903272 AGGGCTTTGCTCTGTCCTCCAGG - Intronic
1068560683 10:58511982-58512004 AGGGCTTTTCTCTGTTTTCAAGG - Intergenic
1068571129 10:58630452-58630474 TGGGTTTTGCTCTGTTGCCCAGG + Intronic
1068895767 10:62198975-62198997 AGGGCTTTACTCTGTTTTCCTGG - Intronic
1069018003 10:63453081-63453103 GGGGTTTTGCTCTGTTTGCCAGG - Intronic
1069764172 10:70840394-70840416 TGGGGTTTGTGCTGTTTTCAAGG + Intronic
1070670437 10:78373924-78373946 AGGGCTTTGCTCTGTCTCCCAGG + Intergenic
1070979260 10:80631272-80631294 AGAGCCTTGCTCTGTTTTCCAGG + Intronic
1071541621 10:86490021-86490043 TGGGGTTTCACCTGTTTGCCAGG - Intronic
1071820184 10:89271869-89271891 GGGGTTTTGATATGTTGTCCAGG - Intronic
1072130447 10:92488985-92489007 AGGGCCTTGCTCTGTTGTCCAGG - Intronic
1072357509 10:94625721-94625743 TGGGTTTTGCTCTGTTGCCCAGG + Intergenic
1073947968 10:108773879-108773901 TGGTCTTTGATCCTGTTTCCTGG - Intergenic
1074429714 10:113383993-113384015 TGGGCTTTGAGCTATTCTGCAGG + Intergenic
1074969983 10:118528204-118528226 AGGGTCTTGCTCTGTTTTCCAGG + Intergenic
1075114290 10:119613029-119613051 TGGGCGTTGGTCCGTATTCCTGG + Intergenic
1075512222 10:123081785-123081807 TGGGCTGGGCTCTGATTTCCAGG - Intergenic
1075869508 10:125759600-125759622 TGGGTTTTGCTCTGTCTCCCAGG - Intronic
1076014188 10:127014773-127014795 TGGGCTTTGGTTTGCTCTCCCGG + Intronic
1077011987 11:383038-383060 AGGGCCTTGCTCTGTTTCCCAGG - Intergenic
1077586467 11:3457703-3457725 TGGGCCTTGCTCTGTTGCCCAGG + Intergenic
1078229753 11:9429476-9429498 AGGGTTTTGATCTGTTGCCCAGG - Intronic
1078855734 11:15205390-15205412 TGAGCTTGGATATGTTATCCTGG + Intronic
1079273129 11:19007219-19007241 TGGGCTTTGCCATGTTGTCCAGG + Intergenic
1079906525 11:26254989-26255011 TGGGATTTGATTTGAATTCCGGG - Intergenic
1080542434 11:33280818-33280840 TGTGCATTGATCTGATTCCCTGG + Intronic
1080852855 11:36085808-36085830 TGGGTTTTGATATGTTGCCCAGG + Intronic
1080905788 11:36543435-36543457 TGGGGTTTGCTCACTTTTCCAGG + Intronic
1081381472 11:42421443-42421465 AGGGCCTTGCTCTGTTGTCCAGG - Intergenic
1082087502 11:48062088-48062110 TGGGTTTTGCTATGTTTCCCAGG + Intronic
1082825913 11:57578709-57578731 AGGATTTTGATCTGTTCTCCAGG - Intergenic
1084194261 11:67515248-67515270 AGGGCTTTGCTCTGTTGCCCAGG + Intergenic
1084233005 11:67766769-67766791 GGGGTTTTGCTCTGTTTCCCCGG - Intergenic
1084242470 11:67831735-67831757 TGGGCCTTGCTCTGTTGCCCAGG + Intergenic
1090369028 11:126234054-126234076 TGGGTCTTGCTCTGTTGTCCAGG - Intronic
1090677987 11:129022369-129022391 TGGGTTTTGTTTTGTTTTGCAGG + Intronic
1091161075 11:133421214-133421236 TGGGCTTTGATCTTGCTTCTTGG - Intronic
1091961943 12:4703134-4703156 TGGGGTTTTATCTGTAGTCCCGG - Intronic
1092090232 12:5798132-5798154 TGGGCTTTGATCTTTCTCTCTGG - Intronic
1092412697 12:8266440-8266462 TGGGCCTTGTTCTGTTGCCCAGG + Intergenic
1094424041 12:30300572-30300594 AGGGTTTTGCTCTGTTGTCCAGG - Intergenic
1095723038 12:45422007-45422029 TGGGCTTATTTCTGGTTTCCTGG - Intronic
1096056275 12:48655060-48655082 TGGGCTTTTCTCTTTTTTCTAGG - Exonic
1096566188 12:52481510-52481532 AGGGTTTTGTTCTGTTATCCAGG - Intergenic
1097679678 12:62637076-62637098 GGGGATTTGATATGTTGTCCAGG + Intergenic
1097949892 12:65415936-65415958 TGGACTTTGATCTGGTGGCCAGG - Intronic
1098099039 12:66993086-66993108 AGGGTCTTGTTCTGTTTTCCAGG - Intergenic
1098580867 12:72097472-72097494 AGAGTTTTGCTCTGTTTTCCAGG + Intronic
1099767515 12:87006860-87006882 GGGGCTTTTATCTCTTTGCCGGG + Intergenic
1100342236 12:93690341-93690363 AGGGCTATCATTTGTTTTCCAGG - Intronic
1100428065 12:94506020-94506042 TGGGCTTGGAGCTGTTTCTCAGG - Intergenic
1100701734 12:97155693-97155715 TCAGCTTAGATCTCTTTTCCAGG + Intergenic
1100949894 12:99835401-99835423 TGGGTCTTGCTCTGTTGTCCAGG - Intronic
1101221451 12:102645478-102645500 TGAAGTTTGATCTTTTTTCCAGG + Intergenic
1103000741 12:117383658-117383680 AGGGTTTTGCTCTGTTTCCCAGG + Intronic
1105812030 13:24004067-24004089 TGGGCTTTGGTCTGTCCTCAAGG + Intronic
1106321285 13:28641817-28641839 AGGGCCTTGCTCTGTTGTCCAGG + Intergenic
1107008903 13:35648067-35648089 TGGGTTTTGCTGTGTTTCCCAGG + Intronic
1107180668 13:37455140-37455162 TCCACTTTGATCTGTTCTCCTGG - Intergenic
1107525637 13:41228541-41228563 TGGGTCTTGCTCTGTTGTCCAGG - Intronic
1108635622 13:52331766-52331788 AGGGTTTTGCTCTGTTGTCCAGG - Intergenic
1108652184 13:52491474-52491496 AGGGTTTTGCTCTGTTGTCCAGG + Intergenic
1108745337 13:53387747-53387769 TGGGATTTTATCTGTTCTCTGGG + Intergenic
1110421283 13:75312385-75312407 TGGGCCTTGCTCTGTTGCCCAGG - Intronic
1111839618 13:93433736-93433758 TGGGCTATGGTGGGTTTTCCAGG + Intronic
1112143848 13:96675942-96675964 TGGGCAGTGATCTGTGCTCCTGG + Intronic
1112497380 13:99915828-99915850 TGGGCTTTGCCATGTTTGCCAGG - Intergenic
1113243291 13:108364546-108364568 TGTTCTTTGACTTGTTTTCCTGG + Intergenic
1115649959 14:35396130-35396152 TGGGCTTTGCTCTGTTGCCCGGG + Intergenic
1116022463 14:39477937-39477959 TGGGGTTTCATCTGTTAGCCAGG + Intergenic
1116215199 14:42007650-42007672 TGGGATGTGTTCTGTCTTCCAGG + Intergenic
1116438382 14:44921243-44921265 TGAGTTTTGATATGTCTTCCAGG - Intergenic
1117255848 14:53976483-53976505 AGGGTTTTGCTCTGTTTCCCAGG - Intergenic
1117562367 14:56954207-56954229 TGTGCTTTGATCCTTTTTCCAGG - Intergenic
1118904353 14:70012772-70012794 TGTGCTTTACTGTGTTTTCCTGG + Intronic
1119039176 14:71257004-71257026 TGGGCATTGATCTGTATTTTGGG + Intergenic
1119412419 14:74441529-74441551 AGGGCTTTGCTCTGTTGCCCAGG + Intergenic
1119577947 14:75744918-75744940 TTAGCTTTCGTCTGTTTTCCAGG + Intronic
1120755171 14:88236289-88236311 TGGGTCTTGCTCTGTTGTCCAGG - Intronic
1121333796 14:93064470-93064492 GGGGCTTTGATCAGGTGTCCTGG - Intronic
1121600056 14:95196655-95196677 GGGGGTTTGCTATGTTTTCCAGG + Exonic
1121851835 14:97228400-97228422 TGAGTTTTGCTCTGTTGTCCAGG + Intergenic
1122279656 14:100613948-100613970 AGGGTTTTGCTCTGTTGTCCAGG + Intergenic
1122677717 14:103430889-103430911 TGGGTCTTGCTCTGTTGTCCAGG + Intronic
1123509083 15:20977838-20977860 AGGGTCTTGCTCTGTTTTCCAGG - Intergenic
1123566306 15:21551585-21551607 AGGGTCTTGCTCTGTTTTCCAGG - Intergenic
1123602570 15:21988871-21988893 AGGGTCTTGCTCTGTTTTCCAGG - Intergenic
1124059892 15:26281327-26281349 TGGGGTTTGCCATGTTTTCCAGG + Intergenic
1124374862 15:29123567-29123589 TGGCCGTTGGTCAGTTTTCCAGG + Exonic
1124589157 15:31037842-31037864 TGTGCTGTGCTCTGTTTTCCAGG - Exonic
1124608061 15:31185823-31185845 AGGGTCTTGCTCTGTTTTCCAGG - Intergenic
1126771296 15:52058972-52058994 TGGGCTACGATCTGTTTTTTTGG + Intronic
1127244388 15:57155752-57155774 AGGGTCTTGATCTGTTGTCCAGG - Intronic
1127263610 15:57343944-57343966 TGGGGTTTGCTGTGTTTCCCAGG + Intergenic
1127543206 15:59963827-59963849 TGGGCCTTGCTATGTTTCCCAGG - Intergenic
1127668934 15:61175689-61175711 TGGGTTTTGCTCTGTGTCCCGGG - Intronic
1127888977 15:63230719-63230741 AGGGCCTTGCTCTGTTTCCCAGG + Intronic
1127954953 15:63845374-63845396 AGGGGCTTGATCTGTCTTCCAGG - Intergenic
1128774109 15:70306524-70306546 AGGGTTTTGCTCTGTTGTCCAGG + Intergenic
1129586587 15:76873504-76873526 TTGACATTGATATGTTTTCCTGG - Intronic
1129596472 15:76968254-76968276 TGGGTCTTGCTCTGTTTCCCAGG + Intergenic
1130267890 15:82425063-82425085 AGGGCTTTGCTCTGTTGACCAGG - Intergenic
1130504134 15:84521771-84521793 AGGGCTTTGCTCTGTTGACCAGG + Intergenic
1130583433 15:85159532-85159554 AGGGTTTTGCTCTGTTGTCCAGG + Intergenic
1202974675 15_KI270727v1_random:278673-278695 AGGGTCTTGCTCTGTTTTCCAGG - Intergenic
1132935770 16:2480154-2480176 TGGGTCTTGCTCTGTTGTCCAGG + Intronic
1133044036 16:3076245-3076267 GGGGCCTTGTTCTGTTGTCCAGG + Intronic
1133143354 16:3764607-3764629 AGGGCCTTGCTCTGTTGTCCAGG + Intronic
1133318790 16:4900463-4900485 AGGGTTTTGCTCTGTTTCCCAGG + Intronic
1134235860 16:12465540-12465562 TGGGCTTTGTTCTGTTCTCATGG + Intronic
1134289036 16:12888646-12888668 AGGCCTTTGACCTGTTTTCCAGG + Intergenic
1134841057 16:17402105-17402127 AGGGCTTTGCTATGTTGTCCAGG - Intronic
1135522208 16:23186278-23186300 TTGGCTTTGATCTTCTCTCCGGG - Exonic
1135559374 16:23463939-23463961 AGGGCTTTGCTCTGTTGCCCAGG - Exonic
1135602919 16:23798422-23798444 AGGGCCTTGGTCTGTCTTCCAGG + Intergenic
1135619263 16:23940548-23940570 TTTGCTTTGTTCTGTTTTCCAGG - Intronic
1136591496 16:31220492-31220514 AGGGCTTTGCTCTGTTGCCCAGG + Intronic
1138133237 16:54499977-54499999 TGGGCCTTCATTTGTCTTCCAGG - Intergenic
1140126592 16:72123426-72123448 TGAGACTGGATCTGTTTTCCAGG + Intronic
1140732817 16:77871712-77871734 TGGGTCTTGCTCTGTTATCCAGG - Intronic
1141123546 16:81383003-81383025 TGGGTTTTGCTCTGTTGCCCAGG + Exonic
1142468850 17:151242-151264 AGGGTTTTGCTCTGTTGTCCAGG - Intronic
1143094739 17:4472461-4472483 TGGGCTCTGCTCTGTCTTCTGGG + Intronic
1143391015 17:6559279-6559301 AGGGATTTGATCTGGTCTCCTGG - Intergenic
1143679874 17:8468353-8468375 TGGGCTTGGCTGTGATTTCCAGG + Intronic
1144293020 17:13844788-13844810 TGGGCTTTGGTTGGTTTGCCTGG + Intergenic
1146191087 17:30767091-30767113 TTGGCTTTGATCGGTTGACCAGG - Intergenic
1146336244 17:31973733-31973755 TTGGCTTTGATCGGTTGACCAGG - Intronic
1147865539 17:43549611-43549633 TGAGCTCTGACCTGTTTCCCAGG + Intronic
1148285222 17:46383835-46383857 TGTGCTTTTATGTGTTTTTCAGG + Intergenic
1148307385 17:46601431-46601453 TGTGCTTTTATGTGTTTTTCAGG + Intronic
1148483605 17:47976383-47976405 TGGGCCTTGCTCTGTTGCCCAGG + Intronic
1149582329 17:57759404-57759426 TGGGTCTTGCTCTGTTGTCCAGG - Intergenic
1149642355 17:58211586-58211608 AGGGTCTTGATCTGTTGTCCAGG + Intronic
1149817685 17:59742489-59742511 AGGGTTTTGCTCTGTTTCCCAGG - Intronic
1149948567 17:60959279-60959301 AGGGGTTTGCTCTGTTTCCCAGG - Intronic
1150276132 17:63899084-63899106 TGTGCTGTGAGCTGTTCTCCAGG + Intergenic
1150278287 17:63913813-63913835 TGTGCTGTGAGCTGTTCTCCAGG + Intronic
1150572443 17:66399122-66399144 AGGGCCTTGCTCTGTCTTCCGGG + Intronic
1151409565 17:73912877-73912899 AGGGTTTTGCTATGTTTTCCCGG + Intergenic
1151650262 17:75463760-75463782 TTGACTTTGATCTCCTTTCCAGG + Intronic
1151706358 17:75770618-75770640 TGGGTTTTGCTCTGTTGGCCAGG + Intergenic
1152963169 18:92610-92632 AGGGCTTTGCTCTGTTGCCCAGG - Intergenic
1153510666 18:5848109-5848131 TGGTATTTGAACAGTTTTCCTGG + Intergenic
1154020498 18:10660459-10660481 AGGTCTTTTCTCTGTTTTCCTGG + Intergenic
1155019148 18:21878823-21878845 TGGGCGTTGCTCTGTTGCCCAGG - Intergenic
1155052566 18:22161677-22161699 TGGGCTTTGCTCTGTTGCCCAGG + Intergenic
1155129113 18:22912302-22912324 TGGTCTTTGACCCTTTTTCCTGG - Intronic
1156937985 18:42734240-42734262 AGGGTCTTGCTCTGTTTTCCAGG - Intergenic
1157321265 18:46636427-46636449 TGGACCTTGATCAGGTTTCCAGG - Intronic
1157692591 18:49695805-49695827 AGGGCCTTGCTCTGTTGTCCAGG + Intergenic
1158314862 18:56200629-56200651 AGGGTTTTGCTCTGTTGTCCAGG + Intergenic
1158896543 18:61919234-61919256 TGGTCTTTGCTCTGGGTTCCTGG - Intergenic
1158936247 18:62367215-62367237 TGGGCTTTGAGCTGCTCTGCAGG - Intronic
1159259620 18:65996169-65996191 AGGGTCTTGCTCTGTTTTCCAGG + Intergenic
1160525558 18:79533521-79533543 TGGGGTTAGCACTGTTTTCCTGG + Intergenic
1160613023 18:80103716-80103738 TGGGATTTGTTCTCTTGTCCTGG + Intergenic
1162002299 19:7753376-7753398 TGGGTCTTGCTCTGTTTCCCAGG - Intergenic
1162229070 19:9250284-9250306 GGGGTTTTGCTGTGTTTTCCAGG + Intergenic
1162538773 19:11280595-11280617 TGGGGTTTGCTCTGTTGCCCAGG + Intergenic
1162613822 19:11779291-11779313 TGGGTTTTGCTCTGTTGCCCAGG - Intronic
1163100016 19:15089808-15089830 AGGGCCTTGCTCTGTTTCCCAGG - Intergenic
1163265740 19:16220228-16220250 AGGGCTTCGATCTGTTGCCCAGG + Intronic
1164607106 19:29607420-29607442 TGGGTTTTGCTCTGTTGCCCTGG - Intronic
1164698658 19:30265914-30265936 AGGGCCTTGATCTGTCATCCAGG + Intronic
1164865704 19:31602599-31602621 AGGGTTTTGCTCTGTTGTCCAGG - Intergenic
1165042972 19:33081897-33081919 AGGGTTTTGCTCTGTTTCCCAGG + Intronic
1165695713 19:37899462-37899484 AAGGCTTTGCTCTGTTTCCCAGG + Intronic
1165855122 19:38875240-38875262 TGGGCCTTGCTCTGTTGCCCAGG + Intronic
1166838199 19:45680334-45680356 AGGGCCTTGTTCTGTTTCCCAGG - Intronic
1166867829 19:45851550-45851572 TGAGTTTTGCTCTGTTGTCCAGG - Intronic
1167476642 19:49705178-49705200 TGGGCTGTGAGCTGCCTTCCAGG - Intronic
1168461059 19:56558979-56559001 TGTGCTTTGATCTGTCTCACTGG - Intergenic
926835033 2:17009460-17009482 GGGGTTTTGCTATGTTTTCCAGG - Intergenic
927720897 2:25381403-25381425 AGGGCTTTGCTCTGTTATCCAGG + Intronic
928581877 2:32716715-32716737 AGGGTCTTGCTCTGTTTTCCAGG + Intronic
929631130 2:43463305-43463327 TTTGCTTTGATCTGTTTTGAGGG - Intronic
929756764 2:44772480-44772502 TGGTCTTTGTTCTGTTTTGGTGG + Exonic
930173101 2:48271804-48271826 GGGGCCTTGCTCTGTTGTCCAGG - Intergenic
930708816 2:54530756-54530778 TGGTCTTTGTTCTGGGTTCCTGG + Intronic
930742509 2:54846507-54846529 AGGGCCTTGCTCTGTTTCCCAGG + Intronic
930807786 2:55508657-55508679 GGGGTCTTGCTCTGTTTTCCAGG - Intergenic
931407619 2:61995135-61995157 AGGGTTTTGCTGTGTTTTCCAGG + Intronic
931654355 2:64497483-64497505 TGGGCTTTGTTCTTTTTTTGTGG - Intergenic
931940505 2:67246900-67246922 TGGTCTCTGATCTGCTTTCTCGG + Intergenic
932018238 2:68054938-68054960 TGGGCCTTGCTCTGTTGCCCAGG - Intronic
932152116 2:69382639-69382661 TGTTCCTTGGTCTGTTTTCCTGG + Intronic
932615572 2:73229146-73229168 TGGGTTTTGCTCTGTTGCCCAGG + Intronic
934737673 2:96698209-96698231 AGGGCTTTTATTCGTTTTCCAGG - Intergenic
935032444 2:99336042-99336064 TGTGCTTTCCTCTGTTTCCCCGG - Intronic
937523428 2:122738702-122738724 TGGTCTTTGTTCTGAATTCCTGG + Intergenic
938461261 2:131498845-131498867 TTCGCTTTGTTCTGTTTTCTAGG + Intergenic
938849310 2:135244277-135244299 GGGGTTTTGATATGTTGTCCAGG - Intronic
939637155 2:144596094-144596116 TTGGCTTTGATCTGGTTGCTAGG - Intergenic
941509061 2:166383667-166383689 AGGGTTTTGCTCTGTTGTCCAGG + Intergenic
941889133 2:170559879-170559901 TGTTCTGTGATCTGTGTTCCTGG + Intronic
944035916 2:195294287-195294309 TGAGCGTTGCTCTGTTGTCCAGG - Intergenic
946004918 2:216516375-216516397 AGGGCTTTGCTCTGTTGCCCAGG + Intronic
946709953 2:222495386-222495408 AGGGCCTTGCTCTGTTTTCCAGG - Intronic
946848178 2:223879632-223879654 TGGGTCTTGCTCTGTTGTCCAGG - Intronic
946937194 2:224734404-224734426 TGGTCTTTGACCTTGTTTCCTGG - Intergenic
947427699 2:229998762-229998784 AGGGTTTTGTTCTGTTGTCCAGG - Intronic
947674933 2:231969969-231969991 AGGGTCTTGCTCTGTTTTCCAGG + Intronic
948847123 2:240688394-240688416 CTGGCTTTGATCTTTGTTCCAGG + Intergenic
949002259 2:241622623-241622645 AGGGTTTTGTTCTGTTTCCCAGG + Intronic
1170341814 20:15337271-15337293 TTGGTTTTGATTTTTTTTCCTGG + Intronic
1170373777 20:15678338-15678360 GGGGCCTTGCTCTGTTGTCCAGG - Intronic
1170491414 20:16879310-16879332 GGGGTTTTGGTATGTTTTCCAGG + Intergenic
1170511240 20:17079103-17079125 TTTTCTTTGCTCTGTTTTCCAGG - Intergenic
1170864607 20:20142428-20142450 TGGGCTTTGAAATGATCTCCAGG - Intronic
1170878465 20:20273070-20273092 AGGGCTATGATGTGTTTCCCAGG + Intronic
1172242490 20:33422739-33422761 TGGGTCTTGCTCTGTTATCCAGG - Intronic
1173269898 20:41524130-41524152 TAGGCTTTGATCTTCTTCCCAGG + Intronic
1173366442 20:42389827-42389849 AGGGTTTTGCTCTGTTTCCCAGG - Intronic
1173630243 20:44507841-44507863 GGGGTTTTGTTCTGTTGTCCAGG - Intronic
1173890665 20:46507086-46507108 TGGGTTTTGCTCTGTTACCCAGG - Intronic
1173991238 20:47305216-47305238 AGGGCTTTGCTCTGTTGTCCAGG - Intronic
1175073305 20:56352855-56352877 TGGGCTTTTATGTGTCATCCTGG - Intergenic
1175520912 20:59602414-59602436 AGAGTTTTGCTCTGTTTTCCAGG - Intronic
1175807712 20:61839047-61839069 GGGTCTGCGATCTGTTTTCCTGG + Intronic
1178022425 21:28424811-28424833 AGGGTCTTGATCTGTTATCCAGG + Intergenic
1178514802 21:33237338-33237360 GGGGCTTTGCTATGTTGTCCAGG - Intronic
1178729998 21:35093057-35093079 AGGGTCTTGCTCTGTTTTCCAGG + Intronic
1179632570 21:42687895-42687917 CGGGCTTGGGTGTGTTTTCCAGG + Exonic
1180575933 22:16774309-16774331 TGTTGTTTGATCTGTTTTGCTGG + Intergenic
1180651967 22:17385124-17385146 GCTGCTTTGATCTGTTCTCCAGG + Intronic
1181081729 22:20419999-20420021 TGGGGGTTGCTATGTTTTCCAGG + Intergenic
1181262625 22:21609513-21609535 TGGGTTTTGCTATGTTGTCCAGG - Intronic
1181300246 22:21874892-21874914 AGGGTTTTGCTCTGTTGTCCAGG + Intergenic
1182038484 22:27217994-27218016 TGGGCTCTGATCACTTTCCCTGG + Intergenic
1182417468 22:30230581-30230603 TGGGTCTTGCTCTGTTGTCCAGG - Intergenic
1182438543 22:30347269-30347291 AGGGTCTTGCTCTGTTTTCCAGG - Intronic
1183261483 22:36798527-36798549 AGGGCTCTGACCTGGTTTCCGGG + Intergenic
1184366175 22:44052915-44052937 AGGGCTTTGCTCTGTCTCCCAGG - Intronic
949310687 3:2694536-2694558 GGGGCTTTGTTATGTTTGCCAGG - Intronic
949338877 3:3007019-3007041 TGGGATTTGGTATGTTTTCAGGG - Intronic
949390355 3:3555291-3555313 TGGGCTTAGAACAGTTTTTCAGG + Intergenic
949859342 3:8491488-8491510 TGGGCTGACATCTGCTTTCCTGG - Intergenic
950062116 3:10080257-10080279 AGGGCTTTGCTCTGTTGCCCAGG + Intronic
950394332 3:12722205-12722227 TGAGCCTTGTTCTGTTGTCCAGG - Intergenic
950705668 3:14778547-14778569 TGGGTTTTGCTCTGTTACCCAGG - Intergenic
951879276 3:27464502-27464524 AGGGGTTTGCTGTGTTTTCCAGG - Intronic
952158095 3:30665709-30665731 TGGGCTCTAGTCTCTTTTCCAGG - Intronic
952341728 3:32452776-32452798 TGGGTTTTGCCCTGTTGTCCAGG + Intronic
952798452 3:37264884-37264906 TGGGTTTTGTTATGTTGTCCAGG + Intronic
953085730 3:39664902-39664924 TGGACTTTGAGCTGTCTTCGTGG + Intergenic
953677927 3:45017778-45017800 AGGGTCTTGCTCTGTTTTCCAGG + Intronic
953812349 3:46124064-46124086 TGGGCTTTGATCTTTTGACTTGG - Intergenic
954076461 3:48185395-48185417 AGGGTCTTGCTCTGTTTTCCAGG - Intronic
954833942 3:53448179-53448201 AGGGTTTTGCTCTGTTGTCCAGG + Intergenic
955235627 3:57136587-57136609 AGAGCTTTGCTCTGTTTCCCAGG - Intronic
956126510 3:66016054-66016076 TGGGTTTTTATCTTCTTTCCTGG - Intronic
956401194 3:68881901-68881923 GAGGCTTTGATGTGTTTTCGTGG - Intronic
956474001 3:69599771-69599793 TTGACTTTGTTCTGTTTGCCAGG + Intergenic
957109387 3:75933234-75933256 TGGGCTCTGCTGTGTTTTTCTGG + Intronic
960357331 3:116669862-116669884 TGGTCTTTGTTCTGGGTTCCTGG + Intronic
960489285 3:118292868-118292890 TGGGCTTTGTTCTGTTATGCAGG + Intergenic
960819220 3:121710055-121710077 TGGGCTTTTTTTTTTTTTCCTGG - Intronic
960935928 3:122902556-122902578 TGGGTTTTGCTCTGTTGCCCAGG - Intergenic
961399884 3:126632181-126632203 TGCGCATTGTTCTGTCTTCCAGG - Intronic
961890257 3:130125087-130125109 TGGGCCTTGTTCTGTTGCCCAGG + Intergenic
962799149 3:138875143-138875165 AGGGTTTTGCTCTGTTTTCCAGG + Intergenic
964918046 3:161860048-161860070 TGGGCTTTGCTTTGTTGGCCAGG + Intergenic
965395993 3:168160966-168160988 AGGGCATTGCTCTGTTGTCCAGG + Intergenic
965529597 3:169757852-169757874 TGGGTCTTGCTCTGTTTCCCAGG - Intergenic
966590053 3:181672927-181672949 AGGGTTTTGCTCTGTTGTCCAGG + Intergenic
967971349 3:195001932-195001954 TGGGCTTAGACCTGTCTTCTCGG + Intergenic
968008483 3:195258405-195258427 TGGTTTTTGATTTGTTTTCTTGG - Intronic
968144980 3:196290338-196290360 TGGGCCTTGTTCTGTTGCCCAGG - Intronic
968217572 3:196906271-196906293 TGGTCTTTGACCTCATTTCCTGG - Intronic
969001663 4:3987637-3987659 TGGGCCTTGCTCTGTTGCCCAGG + Intergenic
969506790 4:7593139-7593161 AGGGCCTTGCTCTGTTGTCCAGG - Intronic
969752362 4:9121026-9121048 TGGGCCTTGCTCTGTTGCCCAGG - Intergenic
969812250 4:9657177-9657199 TGGGCCTTGCTCTGTTGCCCAGG - Intergenic
969822161 4:9729109-9729131 GGGGTTTTGCTCTGTTTCCCTGG + Intergenic
971348365 4:25833212-25833234 TGGGTTTTGCTTTGTTTTCGTGG - Intronic
972638798 4:40907698-40907720 AGGGTCTTGCTCTGTTTTCCAGG + Intronic
973976450 4:56267756-56267778 TGGACTTTGTTCCATTTTCCAGG + Intronic
974072241 4:57134883-57134905 TGGGATTTTACCTGTTTGCCAGG + Intergenic
974560902 4:63516314-63516336 TGGGCTTTTACCGGTTTTCAAGG + Intergenic
974659634 4:64870446-64870468 TGAGCTGTTATATGTTTTCCTGG - Intergenic
975990162 4:80250916-80250938 TGGGTTTTCACCTGTTGTCCAGG - Intergenic
976785049 4:88809864-88809886 TGGGCTTTTTTTTTTTTTCCTGG + Intronic
977229348 4:94433300-94433322 AGGGTTTTGCTCTGTTGTCCAGG - Intergenic
977554379 4:98473808-98473830 TGGGTTTTGCTCTGTTGCCCAGG + Intronic
980079370 4:128327754-128327776 TGGGCTTTGTTCACTTTTTCAGG + Intergenic
981812489 4:148791459-148791481 AGGGCCAAGATCTGTTTTCCAGG + Intergenic
982779476 4:159476000-159476022 TGGGTTTTACTCTGTTGTCCAGG + Intergenic
982881499 4:160723955-160723977 AGGGTCTTGCTCTGTTTTCCAGG + Intergenic
984168076 4:176326725-176326747 TTGGCTCTTGTCTGTTTTCCTGG + Intronic
988791250 5:34609887-34609909 AGGGCTTTGTTCTGTTGACCAGG - Intergenic
989424377 5:41278976-41278998 TGGGCTTTGATTTGTTTGGTAGG + Intergenic
989640134 5:43576302-43576324 TGGGTCTTAATCTGTTGTCCAGG - Intergenic
990206802 5:53438496-53438518 TAGGTTTTGATCTGTTTAACAGG - Intergenic
990318573 5:54607739-54607761 GGGGCTTTGCTATGTTGTCCAGG - Intergenic
990432599 5:55751257-55751279 AGGGCCTTGCTCTGTTGTCCAGG + Intronic
990824349 5:59880299-59880321 AGGGTTTTGGTCTGTTGTCCAGG + Intronic
991657499 5:68918666-68918688 TGGTCTTTGAAATATTTTCCAGG - Intergenic
992006089 5:72478866-72478888 TGGGCTTTGGACTGATTTCAGGG - Intronic
992331907 5:75725675-75725697 GGGTCTTTGAACTGTTTCCCTGG + Intergenic
992743855 5:79799910-79799932 TGGACTTCCATCTGTTTTACTGG + Exonic
993610890 5:90052910-90052932 GGGGTTTTGATATGTTGTCCAGG - Intergenic
995000415 5:107120970-107120992 GGGGTTTTGTTATGTTTTCCAGG - Intergenic
995011018 5:107257317-107257339 TGGGTCTTGCTCTGTTATCCAGG - Intergenic
995121512 5:108540691-108540713 TGGGTCTTGATCTGTTTCACAGG - Intergenic
996971245 5:129370980-129371002 TGGCCTTTTATTTCTTTTCCAGG + Intergenic
997195932 5:131979944-131979966 TTGGCTTTGGTCAGTGTTCCTGG + Intronic
999227650 5:150040419-150040441 GGGGCTTTGCTATGTTGTCCAGG + Intronic
1000389165 5:160705239-160705261 AGGGATTTGCTCTGTTGTCCAGG + Intronic
1001203118 5:169737434-169737456 TGGTCTTTGATCCTTTTTCCTGG + Intronic
1002151034 5:177231109-177231131 AGGGTTTTGTTCTGTTGTCCAGG + Intronic
1002872735 6:1181843-1181865 AGGGCGTTGCTCTGTTTCCCAGG + Intergenic
1003380570 6:5621141-5621163 AGGGCTTTGTTCTGTTGCCCAGG + Intronic
1004564212 6:16780386-16780408 TGGGCCTTGCTCTGTTGCCCAGG + Intergenic
1004951448 6:20677259-20677281 TGGGCTTTCACCTGTTGTCCCGG + Intronic
1005094662 6:22101654-22101676 TGAACTTTGATTTGTTTTCTTGG - Intergenic
1006901379 6:37504221-37504243 TGGGCTATAATCTGCTGTCCTGG - Intergenic
1007534816 6:42576957-42576979 TGGTCTTTGATCTGGTTTCCAGG - Intronic
1007688652 6:43683146-43683168 TGGGCTTTGATCTGTTTTCCAGG - Intronic
1007710389 6:43819395-43819417 TGGGTTTTTCTCTGTTTTTCTGG + Intergenic
1007778772 6:44239044-44239066 TGGGCATTGTTCAGTGTTCCAGG - Intergenic
1008275922 6:49544193-49544215 AGGGTTTTGCTCTGTTGTCCAGG - Intergenic
1011480909 6:87792690-87792712 AGGGCCTTGCTCTGTTGTCCAGG - Intergenic
1013483380 6:110571745-110571767 AGGGCTTTGCTCTGTTGCCCAGG + Intergenic
1013756656 6:113469783-113469805 TGGGTTTTGCTATGTTGTCCAGG - Intergenic
1015871968 6:137784836-137784858 AGGGTTTTGCTCTGTTGTCCTGG - Intergenic
1016502051 6:144732736-144732758 AGGGTTTTGCTCTGTTGTCCAGG + Intronic
1017694904 6:157004936-157004958 TGAGCCTTGCTCTGTTGTCCAGG + Intronic
1017945533 6:159093997-159094019 TGCGCTTTGATCCAGTTTCCCGG + Intergenic
1018226905 6:161637502-161637524 TGGGCTTTGTTCTTTTATTCTGG - Intronic
1020079554 7:5280135-5280157 AGGGCTTTGCTCTATTGTCCAGG + Intronic
1020316689 7:6910394-6910416 GGGGTTTTGCTCTGTTTCCCCGG - Intergenic
1021741861 7:23694993-23695015 GGGGTTTTGCTTTGTTTTCCAGG + Intronic
1021742224 7:23698350-23698372 GGAGCTTTGATTTGTTTTCTAGG + Intronic
1022271026 7:28808301-28808323 TAGGATTTCATCTGCTTTCCTGG + Intronic
1022555144 7:31286647-31286669 AGGGTTTTGCTCTGTTGTCCAGG + Intergenic
1024392430 7:48830916-48830938 TGTGCTTTTTTCTGTATTCCAGG + Intergenic
1025184665 7:56848288-56848310 AGGGCCTTAATATGTTTTCCAGG - Intergenic
1025199343 7:56952058-56952080 AGGGCTTTGCTCTATTGTCCAGG - Intergenic
1025672605 7:63624875-63624897 AGGGCTTTGCTCTATTGTCCAGG + Intergenic
1025687265 7:63728674-63728696 AGGGCCTTAATATGTTTTCCAGG + Intergenic
1026111373 7:67461331-67461353 AGGGCCTTGCTCTGTTTCCCAGG + Intergenic
1027388521 7:77682134-77682156 AGGGCCTTGCTCTGTTGTCCAGG + Intergenic
1027632557 7:80624678-80624700 AGGGTTTTGCTGTGTTTTCCAGG - Intronic
1029696824 7:102219025-102219047 AGGGTCTTGATCTGTTGTCCAGG - Intronic
1030846135 7:114414294-114414316 TTGGCTTTGTACTCTTTTCCTGG + Intronic
1031362470 7:120863060-120863082 TGGGATTTGCTATGTTTCCCAGG - Intergenic
1032531507 7:132624547-132624569 TGGGCTTTGAATTGGTTTCTAGG - Intronic
1032548000 7:132759529-132759551 TGGGAATTGTGCTGTTTTCCTGG + Intergenic
1032718111 7:134528221-134528243 TGGACTTAAAACTGTTTTCCAGG + Intronic
1033057369 7:138070744-138070766 AGGGTCTTGCTCTGTTTTCCAGG - Intronic
1033454562 7:141491051-141491073 TGGGTCTTGATCTGTTGCCCAGG + Intergenic
1034367875 7:150567579-150567601 TAGGCTGTGATCTGTTTTCAAGG + Intronic
1034604692 7:152301168-152301190 AGGGTCTTGCTCTGTTTTCCAGG - Intronic
1035164275 7:156975504-156975526 TGGGCTCTGTTCTGTTCCCCAGG + Intergenic
1035297281 7:157874267-157874289 GGGGCTGTGATCTGATTTGCAGG - Intronic
1036524886 8:9525860-9525882 TGGGCTTTGAATTGTTTCCGTGG - Intergenic
1036790264 8:11712833-11712855 GGGTCTTTGCTCTGTTCTCCAGG - Intronic
1036917993 8:12822854-12822876 TAGGATTTGACCTGTTTCCCAGG - Intergenic
1037163879 8:15803261-15803283 TAGGCTTTAATTTTTTTTCCTGG - Intergenic
1037316109 8:17600954-17600976 TGGGCCTTGCTCTGTCTCCCAGG - Intronic
1037459851 8:19097937-19097959 AGGGCCTTGCTCTGTTGTCCAGG + Intergenic
1037607934 8:20453092-20453114 TGGGCTTTGATGATCTTTCCTGG + Intergenic
1037873480 8:22522633-22522655 TGGACTTTCATCTCTTTTTCAGG + Exonic
1037958032 8:23073909-23073931 TGGGTTTTGCTATGTTTCCCAGG - Intergenic
1038053097 8:23831718-23831740 TGGGTTTTGATCTTTGCTCCAGG + Intergenic
1038334621 8:26636206-26636228 TGAGCTTTGAGTTGTTTTCTAGG + Intronic
1038795195 8:30703553-30703575 TGGGTTTTGACATGTTTCCCAGG - Intronic
1038867413 8:31454926-31454948 TGGACCTTGATCCCTTTTCCTGG - Intergenic
1041454573 8:58044077-58044099 TGGGCTTAGATATGTTTTGGGGG + Intronic
1042086436 8:65114514-65114536 TGGGCTTTCATCACTTTTCTTGG - Intergenic
1042142538 8:65693926-65693948 TGGGTCTTGTTCTGTTTTTCAGG + Intronic
1042228577 8:66534713-66534735 TGGGTTTTGCTCTGTTGCCCAGG + Intergenic
1043189566 8:77201622-77201644 TGTGCTTAGAATTGTTTTCCTGG + Intergenic
1044325078 8:90849441-90849463 AGGGTTTTGCTCTGTTGTCCAGG - Intronic
1044818509 8:96138008-96138030 TTGGTTTTTATCTGTTTTCAGGG + Intergenic
1045229240 8:100285656-100285678 AGGGCTTTGCTCTGTTGCCCAGG + Intronic
1045320559 8:101079070-101079092 TGGGTTTTGCTCTGTTGCCCAGG - Intergenic
1045756289 8:105546541-105546563 TGAGCTTTGCTCTTGTTTCCAGG - Intronic
1047163522 8:122409463-122409485 TGGGATGTGGTCTGTTTTCAGGG + Intergenic
1047297590 8:123584925-123584947 TGGGCTCTGACCAGTTTGCCTGG + Intergenic
1048663634 8:136635424-136635446 TGGGTCTTGCTCTGTTGTCCAGG + Intergenic
1049862450 8:144909116-144909138 AGGGTTTTGCTCTGTTGTCCAGG + Intergenic
1050531565 9:6594502-6594524 AGGGCTTTGCCATGTTTTCCAGG - Intronic
1050626073 9:7504734-7504756 TGGGCTTGGATCTGTTTTGAAGG + Intergenic
1051512245 9:17891145-17891167 TGGGGTTTGCTATGTTGTCCAGG - Intergenic
1052387199 9:27835927-27835949 TGGGCGTTAATCTGTTTTCATGG + Intergenic
1052699842 9:31924355-31924377 TGGGCTTTGTTCTTTTTCCTTGG + Intergenic
1053118821 9:35529975-35529997 TGGGCCTTGTTCTGTTGTCCAGG + Intronic
1053253576 9:36595839-36595861 TGAGCCTTGCTCTGTTATCCAGG + Intronic
1054728630 9:68677958-68677980 AGGGTTTTGCTCTGTTTCCCAGG - Intergenic
1055892082 9:81134322-81134344 TGGGTCTTGCTCTGTTGTCCAGG + Intergenic
1056328149 9:85499271-85499293 TGGGCTTTATTCTGTTTTACTGG - Intergenic
1056372049 9:85966130-85966152 TGGGTTTTGCTTTGTTTGCCAGG + Intronic
1057176741 9:93005796-93005818 TGGACTTTTAACTGTTTTACAGG + Intronic
1057334311 9:94143916-94143938 TAGGAATTGATCTGTTATCCTGG - Intergenic
1059027243 9:110648342-110648364 TGGGTTTTGCTGTGTTGTCCAGG - Intergenic
1059840786 9:118213278-118213300 GGGGCTTAGAATTGTTTTCCAGG + Intergenic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061607600 9:131722838-131722860 AGGGTTTTGCTCTGTTATCCAGG - Intronic
1062734922 9:138131084-138131106 AGGGCTTTGCTCTGTTGCCCAGG + Intergenic
1186013833 X:5168205-5168227 AGGGCTTTGCTCTGTTGTCCAGG + Intergenic
1187330378 X:18333249-18333271 AGGGTTTTGCTCTGTTGTCCAGG - Intronic
1189419971 X:40848220-40848242 AGGGCCTTGCTCTGTTATCCAGG + Intergenic
1189600675 X:42621589-42621611 AGGGCCTTGCTCTGTTGTCCAGG - Intergenic
1190359223 X:49633740-49633762 AGGGCCTTGCTCTGTTATCCAGG + Intergenic
1191037853 X:56046854-56046876 TAGGCGATGATCTTTTTTCCAGG + Intergenic
1191609665 X:63099109-63099131 AGGGCCTTGCTCTGTTGTCCAGG - Intergenic
1193390969 X:80928937-80928959 AGGGTTTTTATCTGTTTCCCAGG + Intergenic
1194001310 X:88432987-88433009 TGGCCTTTTATATGTTTTCCAGG + Intergenic
1194035094 X:88860863-88860885 AGGGTTTTACTCTGTTTTCCAGG - Intergenic
1194122262 X:89975830-89975852 TGGCCTTTGCTGTGTCTTCCTGG + Intergenic
1194236616 X:91392123-91392145 TGGGCAATAATCTTTTTTCCTGG + Intergenic
1194807849 X:98351496-98351518 TGGTTTTTGATCTGTTTTACTGG + Intergenic
1195515122 X:105765104-105765126 TGGGTTTTGTTCTGTTTTGGAGG + Intronic
1197133888 X:123038316-123038338 TGGGCATGGATTTGCTTTCCTGG + Intergenic
1197771235 X:130090836-130090858 TGGGTTTTGATCTGTCACCCAGG + Intronic
1200475121 Y:3633265-3633287 TGGCCTTTGCTGTGTCTTCCTGG + Intergenic
1201596998 Y:15681272-15681294 AGGGCTTTACTCTGTTTTCCAGG + Intergenic
1201653010 Y:16312153-16312175 TGGGTCTTGCTCTGTTGTCCAGG - Intergenic
1201861945 Y:18608147-18608169 AGGGCTTTGCTATGTTGTCCAGG - Intergenic
1201871378 Y:18712233-18712255 AGGGCTTTGCTATGTTGTCCAGG + Intergenic
1202365773 Y:24162824-24162846 AGGGCTTTGCTCTGTTGACCAGG - Intergenic
1202505009 Y:25507298-25507320 AGGGCTTTGCTCTGTTGACCAGG + Intergenic