ID: 1007688938

View in Genome Browser
Species Human (GRCh38)
Location 6:43685497-43685519
Sequence ACCAAAAATGTCTGCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 3, 1: 28, 2: 60, 3: 96, 4: 305}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007688929_1007688938 20 Left 1007688929 6:43685454-43685476 CCTCGCCTCTACCCCCCAGATGC 0: 1
1: 0
2: 36
3: 348
4: 1035
Right 1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG 0: 3
1: 28
2: 60
3: 96
4: 305
1007688928_1007688938 21 Left 1007688928 6:43685453-43685475 CCCTCGCCTCTACCCCCCAGATG 0: 1
1: 0
2: 38
3: 353
4: 1109
Right 1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG 0: 3
1: 28
2: 60
3: 96
4: 305
1007688930_1007688938 15 Left 1007688930 6:43685459-43685481 CCTCTACCCCCCAGATGCCAGTA 0: 1
1: 31
2: 282
3: 776
4: 1724
Right 1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG 0: 3
1: 28
2: 60
3: 96
4: 305
1007688932_1007688938 8 Left 1007688932 6:43685466-43685488 CCCCCAGATGCCAGTAGTACCAG 0: 1
1: 1
2: 12
3: 112
4: 579
Right 1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG 0: 3
1: 28
2: 60
3: 96
4: 305
1007688935_1007688938 5 Left 1007688935 6:43685469-43685491 CCAGATGCCAGTAGTACCAGTTG 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG 0: 3
1: 28
2: 60
3: 96
4: 305
1007688936_1007688938 -2 Left 1007688936 6:43685476-43685498 CCAGTAGTACCAGTTGTGACAAC 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG 0: 3
1: 28
2: 60
3: 96
4: 305
1007688933_1007688938 7 Left 1007688933 6:43685467-43685489 CCCCAGATGCCAGTAGTACCAGT 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG 0: 3
1: 28
2: 60
3: 96
4: 305
1007688931_1007688938 9 Left 1007688931 6:43685465-43685487 CCCCCCAGATGCCAGTAGTACCA 0: 1
1: 1
2: 14
3: 118
4: 635
Right 1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG 0: 3
1: 28
2: 60
3: 96
4: 305
1007688934_1007688938 6 Left 1007688934 6:43685468-43685490 CCCAGATGCCAGTAGTACCAGTT 0: 1
1: 0
2: 0
3: 18
4: 128
Right 1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG 0: 3
1: 28
2: 60
3: 96
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007688938 Original CRISPR ACCAAAAATGTCTGCAGACA TGG Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
902675285 1:18004503-18004525 ACTGCAAATGTCTGCTGACAGGG - Intergenic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
904628139 1:31820254-31820276 ACCAAAAATTTAGTCAGACATGG - Intergenic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907211502 1:52827693-52827715 ATTAAAAATGTCTGCAGGCTGGG - Intergenic
907364616 1:53947576-53947598 ACCAAAAGTGTCTGCAGCCTTGG + Intronic
909789925 1:79663252-79663274 ACCAGAAATTTATACAGACAGGG - Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911333463 1:96552583-96552605 ATCAAACACATCTGCAGACATGG + Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
911852251 1:102834717-102834739 ACAAGAAATGTGTGCAGACCAGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
914202256 1:145496064-145496086 ATCAAAAATGTCTACAGGCTGGG + Intergenic
914236186 1:145813979-145814001 ATCAAAAATGTCTACAGGCTGGG + Intronic
914320283 1:146552390-146552412 AACAAAAATATTTGCAAACAGGG - Intergenic
914424618 1:147563713-147563735 TCCAAAAATGACTTCAGACGTGG - Intronic
914481382 1:148069206-148069228 ATCAAAAATGTCTACAGGCTGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916845548 1:168646331-168646353 ACCAAAAATGACCGTAGTCACGG - Intergenic
917713871 1:177713847-177713869 AGCATAAGTGTCTTCAGACATGG - Intergenic
917829900 1:178871138-178871160 ACCAAAAATTGCTGGAGACTGGG + Intronic
917891404 1:179441833-179441855 GCAAGAAATGTCTGCAGACCAGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918718822 1:187826059-187826081 ACCAAACATATCTGCAACCAAGG - Intergenic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
919730109 1:200908423-200908445 ACAAAAGATAACTGCAGACATGG + Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921511310 1:216034082-216034104 AGGAAAAATATCTGAAGACAAGG + Intronic
921699939 1:218257563-218257585 AAAAAAAATTTCTGCTGACATGG - Intergenic
922584756 1:226725260-226725282 AGCACAGGTGTCTGCAGACAAGG + Intronic
1063900341 10:10726374-10726396 ACAAAACATGTCAGCAGAAACGG - Intergenic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1065287016 10:24195956-24195978 AAAAAAAATTTCTGTAGACATGG - Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1068165500 10:53326673-53326695 AACAAAAATGACTCCTGACACGG - Intergenic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1070038852 10:72754878-72754900 GCAAAAAATGTCTGCAAACTGGG - Intronic
1070410182 10:76132611-76132633 AGCAAAGATTTCTGCAGACTGGG + Intronic
1071019533 10:81035860-81035882 CCCAAAAATGGCTGCACAGATGG - Intergenic
1071415449 10:85437050-85437072 ATCCAAAATGTCTGCAGGAATGG - Intergenic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1072249359 10:93569368-93569390 ACTAAAATTGTGTGCTGACAGGG + Intronic
1072346976 10:94517521-94517543 ACCTAATAAGTCTGCAGCCAGGG - Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074180534 10:111059085-111059107 TCCAAAAATGTAGGCAGGCATGG + Intergenic
1074228194 10:111508025-111508047 ACTAATAATGTCTTCAGAGATGG - Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076803827 10:132845334-132845356 TCCAGAGATGTCTGCAGACATGG - Intronic
1077131137 11:973259-973281 ACCAAAAATGCCCCAAGACACGG - Intronic
1077309962 11:1883933-1883955 ACCAGAAATGTCAGCAGCCCAGG + Exonic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1081522064 11:43891669-43891691 GCCACAAATTTCTGCAGACAGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085353966 11:75818986-75819008 ATCAAAAATGAGTTCAGACATGG + Intronic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1086425769 11:86680998-86681020 ACAAAAAATGTTTGCAGAATAGG - Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090071294 11:123546778-123546800 ACTACAAATGTCAGCATACAGGG + Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1098815420 12:75155146-75155168 GCCAAAAATTTCTGCAGGCATGG - Intronic
1099398365 12:82170179-82170201 AGCAAGAAAGTCTGAAGACATGG + Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100829741 12:98506782-98506804 ACCAAGGATGTGTGCACACAGGG + Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102295089 12:111730240-111730262 ACCAAAAATCTTCGCAGACCTGG + Intronic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1103722861 12:122983884-122983906 ACCAAAAATGTTTACAGAGTTGG - Exonic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1107245355 13:38287330-38287352 ACCAGAAATGTTTGCAGTCCAGG + Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109178910 13:59189594-59189616 ACCAAACATAGCTGCAGAGAAGG - Intergenic
1109847079 13:68007735-68007757 ACAAAAAATGTTTTCAGCCATGG + Intergenic
1111176033 13:84597485-84597507 ACCAAAAATGGCCACATACAGGG - Intergenic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1113255989 13:108505648-108505670 ACCAAAAATCTGTGCAGCAAAGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117625093 14:57628084-57628106 ACCAAAAATGTACGTAGACAAGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1121958139 14:98233215-98233237 AACAGAAATGATTGCAGACAGGG + Intergenic
1127414687 15:58746602-58746624 AAGAAAAATGTCTTAAGACAAGG + Intronic
1128794635 15:70456340-70456362 ACTAAAATTTTCTGCAGAAATGG - Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131189487 15:90302214-90302236 AACAAAAATGTCTGCAAAACTGG + Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133399790 16:5477222-5477244 ACCAAAAATATCTTCAGCCTGGG - Intergenic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134161998 16:11898861-11898883 ATTAAAAATATCTGCAGAAAAGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135060350 16:19266292-19266314 ACCCCAAATGTCTTCGGACATGG - Intronic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135509924 16:23073562-23073584 AACTAAAATGACTGCAGTCAAGG - Intronic
1136492589 16:30619207-30619229 ACAAACAATGTCGTCAGACACGG + Intronic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137330900 16:47494468-47494490 AACAAAAATGCCTGTAAACATGG + Intronic
1137779091 16:51081944-51081966 ACCAAGTATGAATGCAGACAGGG + Intergenic
1137893180 16:52183605-52183627 AACATAAATGTGTACAGACATGG - Intergenic
1138661440 16:58520559-58520581 ACCAGGAATGTCAGAAGACATGG + Exonic
1138855107 16:60681350-60681372 GCCAAAAATGTCAGAAAACATGG + Intergenic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1140013250 16:71157716-71157738 AACAAAAATATTTGCAAACAGGG + Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147909083 17:43844071-43844093 ATCAAAAATGTCTCCAGGCTGGG - Intergenic
1148381419 17:47201254-47201276 ACCAAAAATGAAAGCAGAAAAGG - Intronic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1151495250 17:74454633-74454655 ACCACAAATGTCTCTGGACACGG + Intergenic
1151495934 17:74458101-74458123 ACCTAAGCTCTCTGCAGACAAGG - Intergenic
1151595313 17:75074820-75074842 ACCAGCAACGTCTGCAGGCAAGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153516506 18:5907620-5907642 TTAAAAAATGTCTGCAGACTGGG - Intergenic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1154054971 18:11004074-11004096 AAAGAAAATGTCTGCAGTCAGGG - Intronic
1155182166 18:23357435-23357457 TCCAAAAATGTCCGGAGAAAAGG + Intronic
1156802743 18:41137560-41137582 ACCAAATATGTCTGTGGGCAAGG + Intergenic
1156839088 18:41590172-41590194 ACCAAAAATGTATATAGAGATGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164144511 19:22503745-22503767 CTCAAAAATGTTGGCAGACATGG + Intronic
1164154911 19:22587578-22587600 ACCCAAAATGTGTACACACAAGG + Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1168243873 19:55100303-55100325 ACCAAAAATGTCTCTGGACGTGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
926144159 2:10386658-10386680 ACCACAAAGGTCTGCAGGCTGGG + Intronic
927541629 2:23917110-23917132 ACCAAAAATGTTTGCCCACATGG + Intronic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
932580806 2:72991622-72991644 ACCCAAGATGGCTGCAGACCAGG + Intronic
935133206 2:100276901-100276923 GCACACAATGTCTGCAGACAGGG + Exonic
935224649 2:101042958-101042980 ACCAGAAAGGGCTGCAGAAAAGG - Intronic
935502447 2:103857878-103857900 ACCAAAAATCACTGCAGTCATGG - Intergenic
935671829 2:105562556-105562578 ATCAAAAATGTCTTCAGGCGGGG + Intergenic
936600865 2:113893028-113893050 ACCAAAAAAGTGTGTAGATAAGG - Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
941650490 2:168087260-168087282 ACCAAATATGGCTCCAGGCAGGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
946623927 2:221590975-221590997 ACCAAGAAATTCTGGAGACACGG + Intergenic
946763890 2:223022259-223022281 ACCAAACATGTCTCCAGGCCGGG + Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1169552968 20:6720084-6720106 ACCAGAAATCTGTGCAGAAATGG - Intergenic
1169560967 20:6800348-6800370 ACATAAACTGTCTGCAGAAAAGG + Intergenic
1169880398 20:10341211-10341233 CCCAACTATGGCTGCAGACATGG + Intergenic
1170370642 20:15644316-15644338 ACCAAAGATCCCTGCAGAGAGGG - Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174177551 20:48654526-48654548 AACAAAAATGTCTCCGGGCAGGG + Intronic
1174204750 20:48830066-48830088 ATCAAAAATGTCTCCAGGCTGGG + Intergenic
1174427533 20:50443171-50443193 ACAGAAAAAGTCTGCAGATATGG - Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1175832414 20:61973403-61973425 AACAAACATGCCTGCAGACCCGG + Intronic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1177799703 21:25816299-25816321 TCCAAAACTGCGTGCAGACATGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179143623 21:38748905-38748927 AGCAAAAATGACTGCAGGCAAGG - Intergenic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1179421686 21:41241411-41241433 AACAAAGATGTCTGCGGCCATGG + Intronic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1180589416 22:16923719-16923741 ACTAAAAAAATCTGCAGCCATGG - Intergenic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1182480532 22:30606135-30606157 AAAAAAAATCTCTGCAAACAGGG - Intronic
1183240424 22:36653673-36653695 GCCACAGGTGTCTGCAGACATGG + Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183795533 22:40113909-40113931 GCCAACAATGTAGGCAGACAGGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
1184018238 22:41801696-41801718 AGCAAAAATCTCTGCACTCATGG - Intronic
1184608216 22:45586393-45586415 ACCAAAAAGGCCTGTAGAGAGGG - Intronic
949944744 3:9180967-9180989 ACAACAGATGTCTGGAGACACGG + Intronic
950874711 3:16261336-16261358 ACCAAAAATCTCTGCTTCCAAGG + Intronic
951284160 3:20788891-20788913 ACCGAAAAGGTCTTCAAACATGG + Intergenic
951826050 3:26870185-26870207 AGAAAAAATTTCTGCAGATAAGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952186888 3:30979364-30979386 AGCAAAAATGTTTGTAGACCAGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953732289 3:45460327-45460349 ACCCCAACTGTCAGCAGACAGGG - Intronic
953800226 3:46017311-46017333 GACAAAAAGGTCTGCAAACATGG - Exonic
953806072 3:46068301-46068323 ACCAAAAATGCTTTCAGACGTGG - Intergenic
954122287 3:48506406-48506428 ACAGAAAATGCCTGCACACATGG - Intergenic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956087947 3:65633248-65633270 ACCACACATGACTCCAGACACGG + Intronic
956172672 3:66444793-66444815 AACAAAAATCTGTGCAAACAGGG + Intronic
957355142 3:79073738-79073760 AGCACAAATGTGTTCAGACAAGG - Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
957526615 3:81386353-81386375 ACCAAAATTGTGTTCAGAAAGGG + Intergenic
958519612 3:95168178-95168200 ACCAGATATGTATGCACACAGGG + Intergenic
958558922 3:95718038-95718060 ACCAAGAATGTCTGCAATTATGG + Intergenic
958628889 3:96663510-96663532 ACCAAAGGTGTTTGCAGACTAGG + Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960791404 3:121435168-121435190 ACAAAAAAAGTCTGCTGTCATGG + Intronic
961739429 3:129023753-129023775 ACCAAAAATGTCTGCAGCTTAGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963151424 3:142049427-142049449 ACAAAAACTCTCAGCAGACAAGG + Intronic
963151610 3:142051242-142051264 ATCAAAAATGTCTCCAGGCCTGG + Intronic
963646064 3:147915910-147915932 ATCAAAAATGTCTCCAGGCCGGG - Intergenic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
963897460 3:150702569-150702591 ATCAAAAATGTCTCCAGGCCGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964261262 3:154840353-154840375 ACAAAAAAAGTATGCAGGCATGG - Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967383028 3:188881595-188881617 AACAGAACTGTCTGTAGACATGG - Exonic
967764274 3:193261071-193261093 ACAAAAAGTGTATGCAGACCAGG + Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970110438 4:12631481-12631503 ACCAAAAATGTTTTCAATCATGG - Intergenic
970228426 4:13883703-13883725 ACCAAAAAAGTCTGTAACCAGGG - Intergenic
972426093 4:38934376-38934398 CCAAAAATTGTCTGCAGAAAGGG - Intronic
972629279 4:40829346-40829368 CCCAAAAGTGGCTGCAGAGACGG + Intronic
973700625 4:53533693-53533715 ATCAAAAATGTCTCCAGGCTGGG - Intronic
975818577 4:78245939-78245961 ACCAGAAATCTTTGCAGACATGG + Intronic
976102986 4:81585433-81585455 AACACAAATGTATGCACACATGG + Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978207625 4:106097422-106097444 AGCATGAATGTCTGTAGACATGG + Intronic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
979381438 4:120011376-120011398 ACCTGAAATGTCTGAAGTCAAGG - Intergenic
981002501 4:139841244-139841266 GCCCAAAAGGTCTGCAGAGAGGG - Intronic
981493352 4:145364929-145364951 ACAAAGAATGTCAGAAGACAGGG + Intergenic
982899999 4:160986786-160986808 ACCAACAATGACAGCAGACGTGG + Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984385699 4:179054506-179054528 ACCAAGATTGTCTTCAGAGAGGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985118058 4:186611504-186611526 AACAAGAATGTCCTCAGACACGG + Exonic
986704831 5:10446361-10446383 ATCAAAAATGTCTCCAGGCCGGG + Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987164545 5:15181672-15181694 GCTAAAAATGTATTCAGACAAGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988302984 5:29457012-29457034 ACCAAGAATATCTGCACACTTGG - Intergenic
988575598 5:32420658-32420680 ATCAAAAATATATGCAGATATGG - Intronic
988745424 5:34130778-34130800 ACCCAAAATGTATACACACAAGG + Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990334983 5:54763843-54763865 ATCAAAAACGTCTTCTGACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991389480 5:66126867-66126889 ACTATAAATGTTTGCATACAGGG - Intergenic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
991974967 5:72176670-72176692 TCCAAAAATGACTGAATACAAGG - Intronic
992577266 5:78127535-78127557 ACCAAAAATGTCCTTTGACAAGG - Intronic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
996193441 5:120573729-120573751 ACTCAAAATGTCTGCAGCCATGG + Intronic
997425377 5:133799283-133799305 ACCAGAAAGGTCTGCAGGGATGG - Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001878567 5:175222513-175222535 TCCAACCATGTCAGCAGACAGGG - Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003889216 6:10549050-10549072 ACCAAAAATGTCTTCACGCTGGG - Intronic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004184262 6:13408456-13408478 AGCAAAAATGTCTGCCTGCAAGG + Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004767654 6:18748615-18748637 ACCAGAAATACCTGCAGCCAGGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007438652 6:41838328-41838350 ACCAAACATATCTGCAACCAAGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1007878876 6:45139949-45139971 GCCAACAATGTGGGCAGACAGGG + Intronic
1008807963 6:55454679-55454701 ACTAAGAATGTTTGCAGACCAGG + Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009417282 6:63429744-63429766 AAAAAAAAAGTCTGAAGACAGGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1010508137 6:76685841-76685863 ACAAAAAATGTGTGCATTCAAGG - Intergenic
1010975865 6:82313041-82313063 GCCAACAGTGTGTGCAGACAGGG + Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014204158 6:118637760-118637782 ACTAAAAATATTTGCAGATATGG + Intronic
1016176945 6:141090767-141090789 ACAAAAAATTTATGCAAACAAGG - Intergenic
1016421364 6:143886818-143886840 ACCCAAAATGTCTACACACCTGG - Exonic
1017578915 6:155838781-155838803 ACAAAAAATGTTAGAAGACAGGG - Intergenic
1017869717 6:158476693-158476715 ACCAAACATGTCTATAGAAAAGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020228316 7:6297630-6297652 ACCACAAAAGACTGAAGACACGG + Intergenic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021024925 7:15653933-15653955 AACAAGAATTTCTGTAGACATGG - Intronic
1021125394 7:16846321-16846343 ACCAAAAATCTCAGCAACCACGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022170222 7:27820308-27820330 ACAAAAAATGTCTGCAGTTTAGG - Intronic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022441133 7:30434360-30434382 ATCAAAAATGCCTCCGGACATGG - Intronic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1024516514 7:50263831-50263853 ACCTATGATGTGTGCAGACATGG + Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1025826718 7:65016709-65016731 AAAAAAAATTTCTGGAGACAAGG + Intergenic
1026318931 7:69252178-69252200 AACAAAAATTTCTGTAGAGATGG + Intergenic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027148760 7:75717302-75717324 AACAAAAATGTGTGCAGGAAAGG + Intronic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027657905 7:80954151-80954173 ACCAAAAATGTATTCGTACAGGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028759144 7:94475552-94475574 GGCAGGAATGTCTGCAGACAAGG + Intergenic
1028891971 7:95998286-95998308 TCTAAAAATGTGGGCAGACATGG + Intronic
1029371196 7:100151873-100151895 AAAAAAAATGTGTGGAGACAGGG + Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032270994 7:130405528-130405550 ACCAAAAAGGTCTGTAAGCATGG - Intronic
1035890836 8:3340993-3341015 ATCAAAAATGTCTGTAGAATTGG + Intronic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1037881560 8:22575785-22575807 ATCAAAACAGTCTGCAAACAAGG - Exonic
1038387604 8:27163941-27163963 ACCAAAAATGTCTTCAAATCTGG + Intergenic
1038620410 8:29137429-29137451 CCCAGGAATGTCTGCAGGCACGG + Intronic
1039208583 8:35185176-35185198 AACTAAAATGTCTTCAGTCAAGG + Intergenic
1040562885 8:48540359-48540381 ACCAAAAAGGGCTGCAAACCAGG - Intergenic
1040994836 8:53391044-53391066 ACCAAAAATATCTGCATCCTAGG - Intergenic
1041415854 8:57608455-57608477 ACCAAAAAAGACTGCAGAGGAGG + Intergenic
1042758887 8:72250076-72250098 ACAAAAAATGTCTGTGGTCAAGG + Intergenic
1044530663 8:93303205-93303227 ACCAATAATGTCTACTGTCATGG + Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1046617051 8:116489258-116489280 ATCAAAAATGCCTCCAGACGTGG + Intergenic
1047043762 8:121028237-121028259 ACCAAAAATATCTGGAGATATGG - Intergenic
1047646270 8:126873823-126873845 ACCAAAAAAGGCTTCAAACAAGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1047872611 8:129101578-129101600 ACCAAAAATGTGTGGAAACCTGG - Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1049105326 8:140609017-140609039 CCGAAAAATGTCTGCAGATCTGG + Intronic
1049533087 8:143166151-143166173 ATCAAAGACGTCTGCAGAAATGG + Intergenic
1049569445 8:143361982-143362004 TCCAAAAATGTCTGACAACAAGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051865191 9:21672585-21672607 ACTAAAAATGTTTGTAGGCAAGG + Intergenic
1052838760 9:33272887-33272909 TCCACAAATGTTTGCATACATGG + Intronic
1055075163 9:72206837-72206859 AACAAAAATGAATGAAGACAGGG - Intronic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1057995011 9:99813917-99813939 ACCAGAAGTGTCTGTAGACTCGG + Intergenic
1058803929 9:108571750-108571772 ACAAAAAATGTCTGGGGGCAGGG + Intergenic
1058913929 9:109547121-109547143 ACCAAAAAACCCTGCAGATATGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1061868096 9:133505804-133505826 ACCAAAGATGTCAGCACAGAAGG - Intergenic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187779466 X:22802448-22802470 AACAAAACTGTCTGCAAACTAGG - Intergenic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1189030015 X:37440939-37440961 AACAAAATTATGTGCAGACAAGG + Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1193837916 X:86368732-86368754 ACAAAAAAATTCTGCAGAGAAGG + Intronic
1194269236 X:91789510-91789532 ACTAAGAAAGGCTGCAGACAAGG - Intronic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196048451 X:111280552-111280574 ACCAAAGATTTCTACATACATGG + Intergenic
1196124800 X:112085656-112085678 ACCAAAAATGCGTCCAGGCATGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1200373801 X:155757701-155757723 ACAAAAAATCTCTGGAGGCAAGG + Intergenic
1200586454 Y:5010499-5010521 ACTAAGAAAGGCTGCAGACAAGG - Intronic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic
1202075093 Y:21029516-21029538 GCAAGAAATGTGTGCAGACAAGG - Intergenic