ID: 1007691961

View in Genome Browser
Species Human (GRCh38)
Location 6:43708221-43708243
Sequence AAAGACCCAGGGATGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007691947_1007691961 24 Left 1007691947 6:43708174-43708196 CCCCGTGGGTCTGTCTCAGACCC No data
Right 1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG No data
1007691952_1007691961 3 Left 1007691952 6:43708195-43708217 CCAGAGGCCACACCCACTGCACA No data
Right 1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG No data
1007691949_1007691961 22 Left 1007691949 6:43708176-43708198 CCGTGGGTCTGTCTCAGACCCAG No data
Right 1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG No data
1007691951_1007691961 4 Left 1007691951 6:43708194-43708216 CCCAGAGGCCACACCCACTGCAC No data
Right 1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG No data
1007691948_1007691961 23 Left 1007691948 6:43708175-43708197 CCCGTGGGTCTGTCTCAGACCCA No data
Right 1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG No data
1007691954_1007691961 -4 Left 1007691954 6:43708202-43708224 CCACACCCACTGCACAGGTAAAG No data
Right 1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG No data
1007691956_1007691961 -10 Left 1007691956 6:43708208-43708230 CCACTGCACAGGTAAAGACCCAG No data
Right 1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG No data
1007691955_1007691961 -9 Left 1007691955 6:43708207-43708229 CCCACTGCACAGGTAAAGACCCA No data
Right 1007691961 6:43708221-43708243 AAAGACCCAGGGATGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007691961 Original CRISPR AAAGACCCAGGGATGGAGCA GGG Intergenic
No off target data available for this crispr