ID: 1007694662

View in Genome Browser
Species Human (GRCh38)
Location 6:43724683-43724705
Sequence GAGACTAAGGAGCAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007694662_1007694667 8 Left 1007694662 6:43724683-43724705 CCTGCCTCCTGCTCCTTAGTCTC No data
Right 1007694667 6:43724714-43724736 AGAGCTCTGGCCACTGTCCTCGG No data
1007694662_1007694668 17 Left 1007694662 6:43724683-43724705 CCTGCCTCCTGCTCCTTAGTCTC No data
Right 1007694668 6:43724723-43724745 GCCACTGTCCTCGGTCTTCCTGG No data
1007694662_1007694666 -5 Left 1007694662 6:43724683-43724705 CCTGCCTCCTGCTCCTTAGTCTC No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694662_1007694672 25 Left 1007694662 6:43724683-43724705 CCTGCCTCCTGCTCCTTAGTCTC No data
Right 1007694672 6:43724731-43724753 CCTCGGTCTTCCTGGAGAAAGGG No data
1007694662_1007694670 24 Left 1007694662 6:43724683-43724705 CCTGCCTCCTGCTCCTTAGTCTC No data
Right 1007694670 6:43724730-43724752 TCCTCGGTCTTCCTGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007694662 Original CRISPR GAGACTAAGGAGCAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr