ID: 1007694666

View in Genome Browser
Species Human (GRCh38)
Location 6:43724701-43724723
Sequence GTCTCTTCTCAAAAGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007694651_1007694666 30 Left 1007694651 6:43724648-43724670 CCCATCCCCTGCCTCCAGAAGAA No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694659_1007694666 1 Left 1007694659 6:43724677-43724699 CCATCCCCTGCCTCCTGCTCCTT No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694653_1007694666 25 Left 1007694653 6:43724653-43724675 CCCCTGCCTCCAGAAGAAAGTTA No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694657_1007694666 16 Left 1007694657 6:43724662-43724684 CCAGAAGAAAGTTACCCATCCCC No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694658_1007694666 2 Left 1007694658 6:43724676-43724698 CCCATCCCCTGCCTCCTGCTCCT No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694660_1007694666 -3 Left 1007694660 6:43724681-43724703 CCCCTGCCTCCTGCTCCTTAGTC No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694662_1007694666 -5 Left 1007694662 6:43724683-43724705 CCTGCCTCCTGCTCCTTAGTCTC No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694656_1007694666 19 Left 1007694656 6:43724659-43724681 CCTCCAGAAGAAAGTTACCCATC No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694655_1007694666 23 Left 1007694655 6:43724655-43724677 CCTGCCTCCAGAAGAAAGTTACC No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694663_1007694666 -9 Left 1007694663 6:43724687-43724709 CCTCCTGCTCCTTAGTCTCTTCT No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694654_1007694666 24 Left 1007694654 6:43724654-43724676 CCCTGCCTCCAGAAGAAAGTTAC No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694652_1007694666 29 Left 1007694652 6:43724649-43724671 CCATCCCCTGCCTCCAGAAGAAA No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data
1007694661_1007694666 -4 Left 1007694661 6:43724682-43724704 CCCTGCCTCCTGCTCCTTAGTCT No data
Right 1007694666 6:43724701-43724723 GTCTCTTCTCAAAAGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007694666 Original CRISPR GTCTCTTCTCAAAAGAGCTC TGG Intergenic
No off target data available for this crispr