ID: 1007694668

View in Genome Browser
Species Human (GRCh38)
Location 6:43724723-43724745
Sequence GCCACTGTCCTCGGTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007694662_1007694668 17 Left 1007694662 6:43724683-43724705 CCTGCCTCCTGCTCCTTAGTCTC No data
Right 1007694668 6:43724723-43724745 GCCACTGTCCTCGGTCTTCCTGG No data
1007694658_1007694668 24 Left 1007694658 6:43724676-43724698 CCCATCCCCTGCCTCCTGCTCCT No data
Right 1007694668 6:43724723-43724745 GCCACTGTCCTCGGTCTTCCTGG No data
1007694664_1007694668 10 Left 1007694664 6:43724690-43724712 CCTGCTCCTTAGTCTCTTCTCAA No data
Right 1007694668 6:43724723-43724745 GCCACTGTCCTCGGTCTTCCTGG No data
1007694665_1007694668 4 Left 1007694665 6:43724696-43724718 CCTTAGTCTCTTCTCAAAAGAGC No data
Right 1007694668 6:43724723-43724745 GCCACTGTCCTCGGTCTTCCTGG No data
1007694659_1007694668 23 Left 1007694659 6:43724677-43724699 CCATCCCCTGCCTCCTGCTCCTT No data
Right 1007694668 6:43724723-43724745 GCCACTGTCCTCGGTCTTCCTGG No data
1007694663_1007694668 13 Left 1007694663 6:43724687-43724709 CCTCCTGCTCCTTAGTCTCTTCT No data
Right 1007694668 6:43724723-43724745 GCCACTGTCCTCGGTCTTCCTGG No data
1007694660_1007694668 19 Left 1007694660 6:43724681-43724703 CCCCTGCCTCCTGCTCCTTAGTC No data
Right 1007694668 6:43724723-43724745 GCCACTGTCCTCGGTCTTCCTGG No data
1007694661_1007694668 18 Left 1007694661 6:43724682-43724704 CCCTGCCTCCTGCTCCTTAGTCT No data
Right 1007694668 6:43724723-43724745 GCCACTGTCCTCGGTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007694668 Original CRISPR GCCACTGTCCTCGGTCTTCC TGG Intergenic
No off target data available for this crispr