ID: 1007694670

View in Genome Browser
Species Human (GRCh38)
Location 6:43724730-43724752
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007694665_1007694670 11 Left 1007694665 6:43724696-43724718 CCTTAGTCTCTTCTCAAAAGAGC No data
Right 1007694670 6:43724730-43724752 TCCTCGGTCTTCCTGGAGAAAGG No data
1007694661_1007694670 25 Left 1007694661 6:43724682-43724704 CCCTGCCTCCTGCTCCTTAGTCT No data
Right 1007694670 6:43724730-43724752 TCCTCGGTCTTCCTGGAGAAAGG No data
1007694659_1007694670 30 Left 1007694659 6:43724677-43724699 CCATCCCCTGCCTCCTGCTCCTT No data
Right 1007694670 6:43724730-43724752 TCCTCGGTCTTCCTGGAGAAAGG No data
1007694664_1007694670 17 Left 1007694664 6:43724690-43724712 CCTGCTCCTTAGTCTCTTCTCAA No data
Right 1007694670 6:43724730-43724752 TCCTCGGTCTTCCTGGAGAAAGG No data
1007694662_1007694670 24 Left 1007694662 6:43724683-43724705 CCTGCCTCCTGCTCCTTAGTCTC No data
Right 1007694670 6:43724730-43724752 TCCTCGGTCTTCCTGGAGAAAGG No data
1007694660_1007694670 26 Left 1007694660 6:43724681-43724703 CCCCTGCCTCCTGCTCCTTAGTC No data
Right 1007694670 6:43724730-43724752 TCCTCGGTCTTCCTGGAGAAAGG No data
1007694663_1007694670 20 Left 1007694663 6:43724687-43724709 CCTCCTGCTCCTTAGTCTCTTCT No data
Right 1007694670 6:43724730-43724752 TCCTCGGTCTTCCTGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007694670 Original CRISPR TCCTCGGTCTTCCTGGAGAA AGG Intergenic
No off target data available for this crispr