ID: 1007694672

View in Genome Browser
Species Human (GRCh38)
Location 6:43724731-43724753
Sequence CCTCGGTCTTCCTGGAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007694662_1007694672 25 Left 1007694662 6:43724683-43724705 CCTGCCTCCTGCTCCTTAGTCTC No data
Right 1007694672 6:43724731-43724753 CCTCGGTCTTCCTGGAGAAAGGG No data
1007694663_1007694672 21 Left 1007694663 6:43724687-43724709 CCTCCTGCTCCTTAGTCTCTTCT No data
Right 1007694672 6:43724731-43724753 CCTCGGTCTTCCTGGAGAAAGGG No data
1007694664_1007694672 18 Left 1007694664 6:43724690-43724712 CCTGCTCCTTAGTCTCTTCTCAA No data
Right 1007694672 6:43724731-43724753 CCTCGGTCTTCCTGGAGAAAGGG No data
1007694665_1007694672 12 Left 1007694665 6:43724696-43724718 CCTTAGTCTCTTCTCAAAAGAGC No data
Right 1007694672 6:43724731-43724753 CCTCGGTCTTCCTGGAGAAAGGG No data
1007694661_1007694672 26 Left 1007694661 6:43724682-43724704 CCCTGCCTCCTGCTCCTTAGTCT No data
Right 1007694672 6:43724731-43724753 CCTCGGTCTTCCTGGAGAAAGGG No data
1007694660_1007694672 27 Left 1007694660 6:43724681-43724703 CCCCTGCCTCCTGCTCCTTAGTC No data
Right 1007694672 6:43724731-43724753 CCTCGGTCTTCCTGGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007694672 Original CRISPR CCTCGGTCTTCCTGGAGAAA GGG Intergenic
No off target data available for this crispr