ID: 1007694843

View in Genome Browser
Species Human (GRCh38)
Location 6:43725511-43725533
Sequence CGTGGCAAACAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007694843_1007694847 -5 Left 1007694843 6:43725511-43725533 CCTTCCTCCTTCTGTTTGCCACG No data
Right 1007694847 6:43725529-43725551 CCACGATGCCTATTGTGATGAGG No data
1007694843_1007694855 10 Left 1007694843 6:43725511-43725533 CCTTCCTCCTTCTGTTTGCCACG No data
Right 1007694855 6:43725544-43725566 TGATGAGGATGGGGGGCAGGCGG No data
1007694843_1007694848 -1 Left 1007694843 6:43725511-43725533 CCTTCCTCCTTCTGTTTGCCACG No data
Right 1007694848 6:43725533-43725555 GATGCCTATTGTGATGAGGATGG No data
1007694843_1007694858 26 Left 1007694843 6:43725511-43725533 CCTTCCTCCTTCTGTTTGCCACG No data
Right 1007694858 6:43725560-43725582 CAGGCGGGGCTTCCTCCCTGTGG No data
1007694843_1007694856 11 Left 1007694843 6:43725511-43725533 CCTTCCTCCTTCTGTTTGCCACG No data
Right 1007694856 6:43725545-43725567 GATGAGGATGGGGGGCAGGCGGG No data
1007694843_1007694857 12 Left 1007694843 6:43725511-43725533 CCTTCCTCCTTCTGTTTGCCACG No data
Right 1007694857 6:43725546-43725568 ATGAGGATGGGGGGCAGGCGGGG No data
1007694843_1007694849 0 Left 1007694843 6:43725511-43725533 CCTTCCTCCTTCTGTTTGCCACG No data
Right 1007694849 6:43725534-43725556 ATGCCTATTGTGATGAGGATGGG No data
1007694843_1007694853 3 Left 1007694843 6:43725511-43725533 CCTTCCTCCTTCTGTTTGCCACG No data
Right 1007694853 6:43725537-43725559 CCTATTGTGATGAGGATGGGGGG No data
1007694843_1007694854 7 Left 1007694843 6:43725511-43725533 CCTTCCTCCTTCTGTTTGCCACG No data
Right 1007694854 6:43725541-43725563 TTGTGATGAGGATGGGGGGCAGG No data
1007694843_1007694850 1 Left 1007694843 6:43725511-43725533 CCTTCCTCCTTCTGTTTGCCACG No data
Right 1007694850 6:43725535-43725557 TGCCTATTGTGATGAGGATGGGG No data
1007694843_1007694851 2 Left 1007694843 6:43725511-43725533 CCTTCCTCCTTCTGTTTGCCACG No data
Right 1007694851 6:43725536-43725558 GCCTATTGTGATGAGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007694843 Original CRISPR CGTGGCAAACAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr