ID: 1007694910

View in Genome Browser
Species Human (GRCh38)
Location 6:43725769-43725791
Sequence TGGGAGAAGCAGAACGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007694892_1007694910 20 Left 1007694892 6:43725726-43725748 CCCTGCCCTCCCTACATAATAGG No data
Right 1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG No data
1007694897_1007694910 11 Left 1007694897 6:43725735-43725757 CCCTACATAATAGGCTTTCCTGG No data
Right 1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG No data
1007694894_1007694910 19 Left 1007694894 6:43725727-43725749 CCTGCCCTCCCTACATAATAGGC No data
Right 1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG No data
1007694895_1007694910 15 Left 1007694895 6:43725731-43725753 CCCTCCCTACATAATAGGCTTTC No data
Right 1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG No data
1007694903_1007694910 -7 Left 1007694903 6:43725753-43725775 CCTGGGCACCCCAAATTGGGAGA No data
Right 1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG No data
1007694899_1007694910 10 Left 1007694899 6:43725736-43725758 CCTACATAATAGGCTTTCCTGGG No data
Right 1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG No data
1007694896_1007694910 14 Left 1007694896 6:43725732-43725754 CCTCCCTACATAATAGGCTTTCC No data
Right 1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007694910 Original CRISPR TGGGAGAAGCAGAACGGGGA AGG Intergenic
No off target data available for this crispr