ID: 1007695285

View in Genome Browser
Species Human (GRCh38)
Location 6:43728480-43728502
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007695285_1007695292 19 Left 1007695285 6:43728480-43728502 CCACGATCACATAGCTAGCCAGT No data
Right 1007695292 6:43728522-43728544 GGGCTTGCTGGGGACAGCAGCGG No data
1007695285_1007695291 9 Left 1007695285 6:43728480-43728502 CCACGATCACATAGCTAGCCAGT No data
Right 1007695291 6:43728512-43728534 GTCATCACTCGGGCTTGCTGGGG No data
1007695285_1007695290 8 Left 1007695285 6:43728480-43728502 CCACGATCACATAGCTAGCCAGT No data
Right 1007695290 6:43728511-43728533 AGTCATCACTCGGGCTTGCTGGG No data
1007695285_1007695289 7 Left 1007695285 6:43728480-43728502 CCACGATCACATAGCTAGCCAGT No data
Right 1007695289 6:43728510-43728532 CAGTCATCACTCGGGCTTGCTGG No data
1007695285_1007695288 -1 Left 1007695285 6:43728480-43728502 CCACGATCACATAGCTAGCCAGT No data
Right 1007695288 6:43728502-43728524 TGAACACACAGTCATCACTCGGG No data
1007695285_1007695287 -2 Left 1007695285 6:43728480-43728502 CCACGATCACATAGCTAGCCAGT No data
Right 1007695287 6:43728501-43728523 GTGAACACACAGTCATCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007695285 Original CRISPR ACTGGCTAGCTATGTGATCG TGG (reversed) Intergenic
No off target data available for this crispr