ID: 1007695287

View in Genome Browser
Species Human (GRCh38)
Location 6:43728501-43728523
Sequence GTGAACACACAGTCATCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007695284_1007695287 2 Left 1007695284 6:43728476-43728498 CCGTCCACGATCACATAGCTAGC No data
Right 1007695287 6:43728501-43728523 GTGAACACACAGTCATCACTCGG No data
1007695285_1007695287 -2 Left 1007695285 6:43728480-43728502 CCACGATCACATAGCTAGCCAGT No data
Right 1007695287 6:43728501-43728523 GTGAACACACAGTCATCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007695287 Original CRISPR GTGAACACACAGTCATCACT CGG Intergenic
No off target data available for this crispr