ID: 1007698139

View in Genome Browser
Species Human (GRCh38)
Location 6:43746886-43746908
Sequence CTCCCTTGGGGGGCTGGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007698122_1007698139 6 Left 1007698122 6:43746857-43746879 CCCATTCCCCTAATTTGGCATCC No data
Right 1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG No data
1007698120_1007698139 19 Left 1007698120 6:43746844-43746866 CCTGGGACTGACTCCCATTCCCC No data
Right 1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG No data
1007698124_1007698139 0 Left 1007698124 6:43746863-43746885 CCCCTAATTTGGCATCCTGCCCC No data
Right 1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG No data
1007698125_1007698139 -1 Left 1007698125 6:43746864-43746886 CCCTAATTTGGCATCCTGCCCCC No data
Right 1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG No data
1007698126_1007698139 -2 Left 1007698126 6:43746865-43746887 CCTAATTTGGCATCCTGCCCCCT No data
Right 1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG No data
1007698123_1007698139 5 Left 1007698123 6:43746858-43746880 CCATTCCCCTAATTTGGCATCCT No data
Right 1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007698139 Original CRISPR CTCCCTTGGGGGGCTGGGAG CGG Intergenic
No off target data available for this crispr