ID: 1007699606

View in Genome Browser
Species Human (GRCh38)
Location 6:43758984-43759006
Sequence GCTCCTCGAAGCTGCCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007699606_1007699611 4 Left 1007699606 6:43758984-43759006 CCTCTTGGGCAGCTTCGAGGAGC No data
Right 1007699611 6:43759011-43759033 AGGCTGCCCCTGCCAGCCCTGGG No data
1007699606_1007699612 5 Left 1007699606 6:43758984-43759006 CCTCTTGGGCAGCTTCGAGGAGC No data
Right 1007699612 6:43759012-43759034 GGCTGCCCCTGCCAGCCCTGGGG No data
1007699606_1007699613 6 Left 1007699606 6:43758984-43759006 CCTCTTGGGCAGCTTCGAGGAGC No data
Right 1007699613 6:43759013-43759035 GCTGCCCCTGCCAGCCCTGGGGG No data
1007699606_1007699617 13 Left 1007699606 6:43758984-43759006 CCTCTTGGGCAGCTTCGAGGAGC No data
Right 1007699617 6:43759020-43759042 CTGCCAGCCCTGGGGGACTGTGG No data
1007699606_1007699610 3 Left 1007699606 6:43758984-43759006 CCTCTTGGGCAGCTTCGAGGAGC No data
Right 1007699610 6:43759010-43759032 GAGGCTGCCCCTGCCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007699606 Original CRISPR GCTCCTCGAAGCTGCCCAAG AGG (reversed) Intergenic