ID: 1007701068

View in Genome Browser
Species Human (GRCh38)
Location 6:43766971-43766993
Sequence GTGGTTAATCTAGAAGCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007701068_1007701070 -8 Left 1007701068 6:43766971-43766993 CCACCGGCTTCTAGATTAACCAC No data
Right 1007701070 6:43766986-43767008 TTAACCACCCACACCCACACAGG No data
1007701068_1007701076 14 Left 1007701068 6:43766971-43766993 CCACCGGCTTCTAGATTAACCAC No data
Right 1007701076 6:43767008-43767030 GCGAGAGTTTCCCTGAATATTGG No data
1007701068_1007701077 17 Left 1007701068 6:43766971-43766993 CCACCGGCTTCTAGATTAACCAC No data
Right 1007701077 6:43767011-43767033 AGAGTTTCCCTGAATATTGGAGG No data
1007701068_1007701079 24 Left 1007701068 6:43766971-43766993 CCACCGGCTTCTAGATTAACCAC No data
Right 1007701079 6:43767018-43767040 CCCTGAATATTGGAGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007701068 Original CRISPR GTGGTTAATCTAGAAGCCGG TGG (reversed) Intergenic
No off target data available for this crispr