ID: 1007701069

View in Genome Browser
Species Human (GRCh38)
Location 6:43766974-43766996
Sequence TGGGTGGTTAATCTAGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007701069_1007701081 29 Left 1007701069 6:43766974-43766996 CCGGCTTCTAGATTAACCACCCA No data
Right 1007701081 6:43767026-43767048 ATTGGAGGTGACAGGACATCAGG No data
1007701069_1007701077 14 Left 1007701069 6:43766974-43766996 CCGGCTTCTAGATTAACCACCCA No data
Right 1007701077 6:43767011-43767033 AGAGTTTCCCTGAATATTGGAGG No data
1007701069_1007701079 21 Left 1007701069 6:43766974-43766996 CCGGCTTCTAGATTAACCACCCA No data
Right 1007701079 6:43767018-43767040 CCCTGAATATTGGAGGTGACAGG No data
1007701069_1007701076 11 Left 1007701069 6:43766974-43766996 CCGGCTTCTAGATTAACCACCCA No data
Right 1007701076 6:43767008-43767030 GCGAGAGTTTCCCTGAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007701069 Original CRISPR TGGGTGGTTAATCTAGAAGC CGG (reversed) Intergenic
No off target data available for this crispr