ID: 1007701075

View in Genome Browser
Species Human (GRCh38)
Location 6:43767000-43767022
Sequence CAGGGAAACTCTCGCCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007701075_1007701082 28 Left 1007701075 6:43767000-43767022 CCACACAGGCGAGAGTTTCCCTG No data
Right 1007701082 6:43767051-43767073 AAAGTACAACTATTGTGCCTTGG No data
1007701075_1007701081 3 Left 1007701075 6:43767000-43767022 CCACACAGGCGAGAGTTTCCCTG No data
Right 1007701081 6:43767026-43767048 ATTGGAGGTGACAGGACATCAGG No data
1007701075_1007701079 -5 Left 1007701075 6:43767000-43767022 CCACACAGGCGAGAGTTTCCCTG No data
Right 1007701079 6:43767018-43767040 CCCTGAATATTGGAGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007701075 Original CRISPR CAGGGAAACTCTCGCCTGTG TGG (reversed) Intergenic
No off target data available for this crispr