ID: 1007701078

View in Genome Browser
Species Human (GRCh38)
Location 6:43767018-43767040
Sequence CCTGTCACCTCCAATATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007701078_1007701082 10 Left 1007701078 6:43767018-43767040 CCCTGAATATTGGAGGTGACAGG No data
Right 1007701082 6:43767051-43767073 AAAGTACAACTATTGTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007701078 Original CRISPR CCTGTCACCTCCAATATTCA GGG (reversed) Intergenic
No off target data available for this crispr