ID: 1007701080

View in Genome Browser
Species Human (GRCh38)
Location 6:43767019-43767041
Sequence TCCTGTCACCTCCAATATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007701080_1007701082 9 Left 1007701080 6:43767019-43767041 CCTGAATATTGGAGGTGACAGGA No data
Right 1007701082 6:43767051-43767073 AAAGTACAACTATTGTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007701080 Original CRISPR TCCTGTCACCTCCAATATTC AGG (reversed) Intergenic
No off target data available for this crispr