ID: 1007701081

View in Genome Browser
Species Human (GRCh38)
Location 6:43767026-43767048
Sequence ATTGGAGGTGACAGGACATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007701069_1007701081 29 Left 1007701069 6:43766974-43766996 CCGGCTTCTAGATTAACCACCCA No data
Right 1007701081 6:43767026-43767048 ATTGGAGGTGACAGGACATCAGG No data
1007701071_1007701081 13 Left 1007701071 6:43766990-43767012 CCACCCACACCCACACAGGCGAG No data
Right 1007701081 6:43767026-43767048 ATTGGAGGTGACAGGACATCAGG No data
1007701075_1007701081 3 Left 1007701075 6:43767000-43767022 CCACACAGGCGAGAGTTTCCCTG No data
Right 1007701081 6:43767026-43767048 ATTGGAGGTGACAGGACATCAGG No data
1007701074_1007701081 4 Left 1007701074 6:43766999-43767021 CCCACACAGGCGAGAGTTTCCCT No data
Right 1007701081 6:43767026-43767048 ATTGGAGGTGACAGGACATCAGG No data
1007701072_1007701081 10 Left 1007701072 6:43766993-43767015 CCCACACCCACACAGGCGAGAGT No data
Right 1007701081 6:43767026-43767048 ATTGGAGGTGACAGGACATCAGG No data
1007701073_1007701081 9 Left 1007701073 6:43766994-43767016 CCACACCCACACAGGCGAGAGTT No data
Right 1007701081 6:43767026-43767048 ATTGGAGGTGACAGGACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007701081 Original CRISPR ATTGGAGGTGACAGGACATC AGG Intergenic
No off target data available for this crispr