ID: 1007701082

View in Genome Browser
Species Human (GRCh38)
Location 6:43767051-43767073
Sequence AAAGTACAACTATTGTGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007701080_1007701082 9 Left 1007701080 6:43767019-43767041 CCTGAATATTGGAGGTGACAGGA No data
Right 1007701082 6:43767051-43767073 AAAGTACAACTATTGTGCCTTGG No data
1007701075_1007701082 28 Left 1007701075 6:43767000-43767022 CCACACAGGCGAGAGTTTCCCTG No data
Right 1007701082 6:43767051-43767073 AAAGTACAACTATTGTGCCTTGG No data
1007701074_1007701082 29 Left 1007701074 6:43766999-43767021 CCCACACAGGCGAGAGTTTCCCT No data
Right 1007701082 6:43767051-43767073 AAAGTACAACTATTGTGCCTTGG No data
1007701078_1007701082 10 Left 1007701078 6:43767018-43767040 CCCTGAATATTGGAGGTGACAGG No data
Right 1007701082 6:43767051-43767073 AAAGTACAACTATTGTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007701082 Original CRISPR AAAGTACAACTATTGTGCCT TGG Intergenic
No off target data available for this crispr