ID: 1007702096

View in Genome Browser
Species Human (GRCh38)
Location 6:43771469-43771491
Sequence GAGGGGGCGCGCGCGCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007702085_1007702096 2 Left 1007702085 6:43771444-43771466 CCCTCTGTCGTCTTAGGTGCAGG 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1007702096 6:43771469-43771491 GAGGGGGCGCGCGCGCTAGGTGG 0: 1
1: 0
2: 2
3: 17
4: 170
1007702087_1007702096 1 Left 1007702087 6:43771445-43771467 CCTCTGTCGTCTTAGGTGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1007702096 6:43771469-43771491 GAGGGGGCGCGCGCGCTAGGTGG 0: 1
1: 0
2: 2
3: 17
4: 170
1007702083_1007702096 4 Left 1007702083 6:43771442-43771464 CCCCCTCTGTCGTCTTAGGTGCA 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1007702096 6:43771469-43771491 GAGGGGGCGCGCGCGCTAGGTGG 0: 1
1: 0
2: 2
3: 17
4: 170
1007702080_1007702096 28 Left 1007702080 6:43771418-43771440 CCATGGGCACCAGGCGTGCGGCG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1007702096 6:43771469-43771491 GAGGGGGCGCGCGCGCTAGGTGG 0: 1
1: 0
2: 2
3: 17
4: 170
1007702081_1007702096 19 Left 1007702081 6:43771427-43771449 CCAGGCGTGCGGCGTCCCCCTCT 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1007702096 6:43771469-43771491 GAGGGGGCGCGCGCGCTAGGTGG 0: 1
1: 0
2: 2
3: 17
4: 170
1007702084_1007702096 3 Left 1007702084 6:43771443-43771465 CCCCTCTGTCGTCTTAGGTGCAG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1007702096 6:43771469-43771491 GAGGGGGCGCGCGCGCTAGGTGG 0: 1
1: 0
2: 2
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007702096 Original CRISPR GAGGGGGCGCGCGCGCTAGG TGG Intronic