ID: 1007702272

View in Genome Browser
Species Human (GRCh38)
Location 6:43772065-43772087
Sequence TTCCCGCGGAGGGCTGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007702272_1007702285 8 Left 1007702272 6:43772065-43772087 CCCCCGCCAGCCCTCCGCGGGAA 0: 1
1: 0
2: 3
3: 11
4: 129
Right 1007702285 6:43772096-43772118 CTCGAGGTAGCCCCAGCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1007702272_1007702283 6 Left 1007702272 6:43772065-43772087 CCCCCGCCAGCCCTCCGCGGGAA 0: 1
1: 0
2: 3
3: 11
4: 129
Right 1007702283 6:43772094-43772116 CTCTCGAGGTAGCCCCAGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 103
1007702272_1007702284 7 Left 1007702272 6:43772065-43772087 CCCCCGCCAGCCCTCCGCGGGAA 0: 1
1: 0
2: 3
3: 11
4: 129
Right 1007702284 6:43772095-43772117 TCTCGAGGTAGCCCCAGCCCGGG 0: 1
1: 0
2: 2
3: 15
4: 170
1007702272_1007702281 -8 Left 1007702272 6:43772065-43772087 CCCCCGCCAGCCCTCCGCGGGAA 0: 1
1: 0
2: 3
3: 11
4: 129
Right 1007702281 6:43772080-43772102 CGCGGGAAGGTGACCTCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007702272 Original CRISPR TTCCCGCGGAGGGCTGGCGG GGG (reversed) Intronic