ID: 1007702272

View in Genome Browser
Species Human (GRCh38)
Location 6:43772065-43772087
Sequence TTCCCGCGGAGGGCTGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007702272_1007702281 -8 Left 1007702272 6:43772065-43772087 CCCCCGCCAGCCCTCCGCGGGAA 0: 1
1: 0
2: 3
3: 11
4: 129
Right 1007702281 6:43772080-43772102 CGCGGGAAGGTGACCTCTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 48
1007702272_1007702285 8 Left 1007702272 6:43772065-43772087 CCCCCGCCAGCCCTCCGCGGGAA 0: 1
1: 0
2: 3
3: 11
4: 129
Right 1007702285 6:43772096-43772118 CTCGAGGTAGCCCCAGCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 115
1007702272_1007702283 6 Left 1007702272 6:43772065-43772087 CCCCCGCCAGCCCTCCGCGGGAA 0: 1
1: 0
2: 3
3: 11
4: 129
Right 1007702283 6:43772094-43772116 CTCTCGAGGTAGCCCCAGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 103
1007702272_1007702284 7 Left 1007702272 6:43772065-43772087 CCCCCGCCAGCCCTCCGCGGGAA 0: 1
1: 0
2: 3
3: 11
4: 129
Right 1007702284 6:43772095-43772117 TCTCGAGGTAGCCCCAGCCCGGG 0: 1
1: 0
2: 2
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007702272 Original CRISPR TTCCCGCGGAGGGCTGGCGG GGG (reversed) Intronic
900569766 1:3352429-3352451 TGCCCGCAGTGGGCTGGGGGAGG + Intronic
903986884 1:27234965-27234987 CGCCCGCGGAGGGCAGGGGGCGG - Intronic
904799153 1:33080966-33080988 CTCCCCCGGAGGCCTGGCGGTGG - Intronic
908703848 1:66930110-66930132 TTCCCGGGGAGGGCTGGCCGCGG + Intronic
910280475 1:85495040-85495062 TTCCAGCAGAGGGCAGGCGGGGG + Intronic
910621484 1:89260076-89260098 TTTCCACAGAGGGTTGGCGGGGG + Intronic
911348111 1:96721574-96721596 TTCCAGAGGACGGCAGGCGGAGG + Intergenic
913286682 1:117233055-117233077 TTCCCGCAGAGGGAAGGAGGAGG - Intergenic
1062838611 10:652369-652391 GTCCCGGGGTGGGGTGGCGGGGG + Exonic
1067033791 10:42898460-42898482 TTCCCTCCGCGGGCTGGGGGTGG - Intergenic
1067769898 10:49115540-49115562 GGCCCGGGGCGGGCTGGCGGCGG - Intergenic
1069557422 10:69407323-69407345 TGCCCTCGGAGGGCTGGGGCTGG - Intronic
1069994526 10:72334399-72334421 CTCCCTCGCAGGGCTGGCGGAGG - Exonic
1071480038 10:86058176-86058198 TTCCATAGGAGGGCTGGGGGAGG - Intronic
1072784169 10:98268809-98268831 TTCACACGGAGGGCGGGGGGGGG - Intergenic
1073624743 10:105085291-105085313 TTCCCTCTGTGGGCTGGAGGAGG + Intronic
1074165795 10:110872454-110872476 TTCCCAGGGAGGGCAGGGGGCGG - Intronic
1075025009 10:118978094-118978116 GTCCCTGGGAGGGCTGGCCGGGG - Intergenic
1092810484 12:12267275-12267297 TCCCCGCGGAGGGCGTGAGGCGG + Intergenic
1096186954 12:49587656-49587678 GTCCCGGGGAAGGCTGGCAGGGG + Exonic
1097106456 12:56629190-56629212 TTCCTGCGGGAGGCTGGGGGAGG + Intronic
1097598532 12:61664214-61664236 TTCCTGGGGAGGGTTGGAGGAGG - Intergenic
1097999428 12:65924069-65924091 TTCCCAAGGTGGGCTGGGGGTGG - Intronic
1103447507 12:121003907-121003929 CTCCCACGGAGGGCTGGCGGGGG - Exonic
1103954141 12:124567267-124567289 TCCCCGCGAAGGGCGGGGGGAGG - Intronic
1103969942 12:124664163-124664185 TTCCAGCTGAGGGCAGGCAGGGG + Intergenic
1104475867 12:129069812-129069834 TTCCCTCGGAGGGTTTGTGGGGG - Intergenic
1114280212 14:21187266-21187288 TTCCAGGGGAGGGCTGGGCGCGG + Intergenic
1116833146 14:49742377-49742399 TTCCCGGGGAGGGCTGGGCGTGG + Intronic
1117449843 14:55839741-55839763 AGCCCACGGAGGGCTGGGGGAGG - Intergenic
1121622010 14:95356745-95356767 TTTCAGGGGAGGGCTGGTGGAGG - Intergenic
1122028445 14:98894968-98894990 GTCCCAGGGAGGGCTGGCAGGGG + Intergenic
1122410155 14:101521656-101521678 TGCCGTGGGAGGGCTGGCGGGGG - Intergenic
1124655021 15:31500571-31500593 CTCTGGCGGAGGGCTGGGGGAGG + Intronic
1124852686 15:33356022-33356044 TTCCTGCAGATGGATGGCGGGGG + Intronic
1125508577 15:40281282-40281304 TTCTGGTGGAGGGCTGGTGGAGG + Intronic
1131493436 15:92882605-92882627 TGGCCGCGGCGGGCGGGCGGCGG + Intergenic
1132687695 16:1169153-1169175 TTCCTGCGGCGGGGTGGGGGTGG + Intronic
1133040879 16:3059242-3059264 CTCCCGCGCAGGGGCGGCGGCGG + Exonic
1133413826 16:5590455-5590477 TTCCTACGAAGGGCTGGGGGTGG + Intergenic
1136501116 16:30670035-30670057 TGCCCTCCGAGGGCTGGGGGAGG + Exonic
1138525893 16:57607065-57607087 TTCCTGCTGAGGGCTGGCTGAGG + Intergenic
1139484045 16:67246383-67246405 TGCCTGCGGGGGGCTGACGGCGG + Intronic
1140976312 16:80063169-80063191 ATCCCGCAGAGGGCTGGGCGTGG + Intergenic
1141665282 16:85462656-85462678 TGCCCGGGGAGCGCGGGCGGGGG + Intergenic
1141959159 16:87392723-87392745 AGCCGGCGGAGGGCGGGCGGGGG + Intronic
1142284300 16:89165504-89165526 TGCCCAGGGAGGGCGGGCGGGGG - Intergenic
1142858866 17:2749308-2749330 TCCCCCGGGAGGGCTGGCGCGGG - Intergenic
1143493089 17:7294913-7294935 TTCCCGCAGAGGCCAGGTGGCGG - Intergenic
1143530014 17:7497297-7497319 TTCCTGCCGAGCGCTGGCAGTGG + Intronic
1146256622 17:31394914-31394936 TTCCAGCGGTGGGGTGGCGGGGG + Intronic
1146652187 17:34613722-34613744 TACCCATGGAGGGCTGGGGGAGG - Intronic
1147421669 17:40324923-40324945 TTCCCTAGGAGGGCTGGAGAAGG - Intronic
1147992864 17:44345648-44345670 TTCCCGCGGCGGCCTGGAGCCGG + Intronic
1152331804 17:79677821-79677843 TCCCCACGGAGGGCTGCCGTGGG + Intergenic
1153636444 18:7117482-7117504 TTGCCGGGGAGGGCTGGATGGGG - Intronic
1158954780 18:62526877-62526899 TTCCCGCGGAGGCCAGGCTTTGG + Intronic
1160147994 18:76379640-76379662 TTGCCACCGAGGGCAGGCGGGGG + Exonic
1160691911 19:464123-464145 ATCCTGCGGGGGGCGGGCGGGGG + Exonic
1160864931 19:1252289-1252311 TTTCTGCTGAGGGCTGGGGGTGG + Intronic
1161061968 19:2219786-2219808 TTCCCGGTGAGGGCGGGCTGTGG + Intronic
1162253880 19:9471818-9471840 TTCCCTCAGAGGGCTGGGTGTGG + Intronic
1163683932 19:18700029-18700051 TTCCCCAGGAGGGTTGGCGACGG + Intronic
1164558168 19:29269323-29269345 CTTCCGCGGAGGACTGGCGATGG + Intergenic
1164989298 19:32673159-32673181 TTCCCTGGGAGGGCAGGCAGAGG - Intronic
1165422257 19:35728040-35728062 TTCCCCAGGAGAGCTGGCAGGGG - Intronic
1166140092 19:40800784-40800806 GTCCCGAAGAGGGCTGGCAGTGG - Exonic
1168561717 19:57390069-57390091 TTCCCTGGCTGGGCTGGCGGAGG + Exonic
926162982 2:10501391-10501413 TTGCCTGGGAGGGTTGGCGGTGG + Intergenic
930449008 2:51510796-51510818 TTCACCCGGAGGGCTTGGGGTGG - Intergenic
932699738 2:73984762-73984784 TTCCCGCGGAGGGGAGGGGTCGG - Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
934301682 2:91780402-91780424 CTCCCCAGGAGGGCTGTCGGTGG + Intergenic
934734959 2:96685514-96685536 TCCCCGAGGAGGGCGGGGGGAGG - Intergenic
936452884 2:112646333-112646355 TTCGCGCGGAGGGCGCGCGCGGG + Intronic
944811037 2:203328111-203328133 CTCCAGCGGCGGGCGGGCGGCGG + Intergenic
948739197 2:240031710-240031732 TTGCTGGGGAGAGCTGGCGGTGG + Intergenic
948784876 2:240347147-240347169 ATCCCCGGTAGGGCTGGCGGCGG - Intergenic
1168820728 20:772114-772136 TTCCCACAGAGGGCTGGATGGGG + Intergenic
1173874840 20:46364051-46364073 TTCCCGCGGTGGGATTGGGGCGG - Intronic
1175647451 20:60686952-60686974 TCCCCGGGGAGGTCTGGAGGAGG + Intergenic
1177779575 21:25607790-25607812 AACCCGCGGAGGGCTGAAGGCGG - Intergenic
1179788211 21:43741355-43741377 GGCTCGCGGGGGGCTGGCGGGGG + Intronic
1179794133 21:43772698-43772720 TTCCAGCGGAAGGCAGGTGGGGG - Exonic
1179920152 21:44503369-44503391 TTCCCGCCGAGGGCTCACCGAGG - Intronic
1179920257 21:44503703-44503725 TTCCCGCCGAGGGCTCACCGAGG - Intronic
1179920324 21:44503916-44503938 TTCCCGCCGAGGGCTCACCGAGG - Intronic
1180728084 22:17961130-17961152 ATCCAGAGGATGGCTGGCGGTGG + Intronic
1180814752 22:18782317-18782339 CTCCCCAGGAGGGCTGTCGGTGG - Intergenic
1181200939 22:21216653-21216675 CTCCCCAGGAGGGCTGTCGGTGG - Exonic
1182003379 22:26939361-26939383 AACCCGGGGAGGGGTGGCGGGGG + Intergenic
1183617252 22:38953373-38953395 TTCCCTCGGAGGACTGGGTGGGG + Intronic
1185242727 22:49755247-49755269 TTCCCGCGGAGGGCCTGCTGTGG - Intergenic
1203225978 22_KI270731v1_random:78782-78804 CTCCCCAGGAGGGCTGTCGGTGG + Intergenic
1203264849 22_KI270734v1_random:8004-8026 CTCCCCAGGAGGGCTGTCGGTGG - Intergenic
951140095 3:19148400-19148422 TGCCCGCGGAGGGACGGTGGGGG + Intergenic
954384274 3:50236232-50236254 TTCCCGCAGAGGGCTGGTGGTGG + Exonic
954461308 3:50628637-50628659 TTCCCACAGAGGGCCGGGGGAGG - Intronic
962354453 3:134681646-134681668 TTCCTGCGGAGGCATGGGGGCGG + Intronic
966378786 3:179323186-179323208 TTCCCGCGGACGCACGGCGGCGG - Intronic
969152970 4:5186187-5186209 GTCCCGAGGAGGGCTGATGGAGG - Intronic
969351461 4:6600403-6600425 TTCCAGGGCAGGGCAGGCGGAGG - Intronic
970994222 4:22247294-22247316 TTCCCTCGGCGGGGTGGAGGGGG + Intergenic
980993960 4:139762883-139762905 TTCCTGAGGAGGGCTGGAGAGGG + Intronic
982171878 4:152670214-152670236 TTCTCCAGGAAGGCTGGCGGGGG + Intronic
984811309 4:183798134-183798156 TGCCCGCGGCGGGCTGGGGCAGG - Intergenic
985248103 4:187996746-187996768 ATCCCGCGAAGGGCTGCCAGGGG - Intronic
985782069 5:1876649-1876671 TTCGGGCGGAGGGCTCGGGGTGG + Intergenic
986636134 5:9823980-9824002 TTGCCTTGGAGGGCTGGGGGAGG + Intergenic
991091434 5:62697257-62697279 TTCTAGCGGAGGGCTGGGCGTGG - Intergenic
993902701 5:93595410-93595432 CTCCCGCTGAGGCCTGTCGGTGG + Intergenic
995724366 5:115169126-115169148 TGCCCGCGGGGGGCGGGCCGGGG - Intronic
996785094 5:127229463-127229485 CTCCCGGGCAGGCCTGGCGGAGG + Intergenic
999753369 5:154646836-154646858 TTCCCGAGGAGCGACGGCGGCGG - Intergenic
1002289058 5:178187364-178187386 TGCTCGGGGAAGGCTGGCGGCGG - Intergenic
1003871152 6:10404389-10404411 TTCCCGCGTAGGGAGGGCCGCGG + Intronic
1006707061 6:36028968-36028990 TTTCCGTGGAGGGGCGGCGGTGG + Intronic
1007702272 6:43772065-43772087 TTCCCGCGGAGGGCTGGCGGGGG - Intronic
1007901990 6:45421761-45421783 TTCTCGCGGCCGGCTGGCGGCGG + Intronic
1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG + Intergenic
1012624760 6:101392687-101392709 TTCCAGGGAGGGGCTGGCGGCGG - Intergenic
1024574118 7:50750146-50750168 TTCCCACGGAGAGCTGCCGGAGG - Intronic
1036771017 8:11578535-11578557 TTCCCAGGGTGGGGTGGCGGTGG - Intergenic
1037820040 8:22131039-22131061 TTCCCGCAGGGTGCTGGAGGAGG - Exonic
1039843146 8:41307954-41307976 TGCCCTCGGAGGGCTGGGGGTGG - Intronic
1040951063 8:52939626-52939648 GTCCCGAGGAGGGGTGGGGGTGG - Exonic
1046871237 8:119208160-119208182 CGCCCGCGGAGCGCTGGCGCTGG + Intronic
1049064411 8:140301691-140301713 TTCCTGCGGAGGCCGGGAGGCGG - Intronic
1049199142 8:141331427-141331449 CTCCCGCGGAGGACAGGAGGAGG - Intergenic
1055554518 9:77461147-77461169 CCCCCGCGGAGGGCTGCAGGGGG + Intronic
1057432175 9:95004754-95004776 AGCCCGGGGAGGGGTGGCGGGGG + Intronic
1060449077 9:123720305-123720327 TTCCCTCGGAGCCCTGGCTGAGG - Intronic
1061127266 9:128684745-128684767 TTCCAGCAGAGAGCTGGAGGTGG - Intronic
1061226037 9:129281564-129281586 AGGCCGCCGAGGGCTGGCGGAGG + Intergenic
1061283323 9:129609567-129609589 TTTCCACTCAGGGCTGGCGGGGG - Intronic
1062001238 9:134216769-134216791 TTCCCGCAGAGGGCTGTGGGAGG - Intergenic
1062020834 9:134318694-134318716 TGCCCGCGAAGGGCTGGCCTGGG + Intronic
1062139532 9:134948237-134948259 TTCCTGGGGAGGGCTGTGGGAGG - Intergenic
1187443795 X:19343689-19343711 TTCCCGCGGCGCCCTGGAGGCGG + Intergenic
1189879125 X:45471092-45471114 TTCCAGTGGAGGGGTGGTGGTGG + Intergenic
1192962514 X:76145369-76145391 TGCTGGGGGAGGGCTGGCGGGGG + Intergenic
1192963019 X:76149718-76149740 TGCTGGGGGAGGGCTGGCGGGGG - Intergenic
1200036462 X:153334577-153334599 TTCCCGAGGCGGGCGGGGGGCGG + Intronic
1200218541 X:154379450-154379472 CTCAGGCGGAGGCCTGGCGGCGG - Exonic