ID: 1007702273 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:43772066-43772088 |
Sequence | CTTCCCGCGGAGGGCTGGCG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 123 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 114} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1007702273_1007702283 | 5 | Left | 1007702273 | 6:43772066-43772088 | CCCCGCCAGCCCTCCGCGGGAAG | 0: 1 1: 0 2: 0 3: 8 4: 114 |
||
Right | 1007702283 | 6:43772094-43772116 | CTCTCGAGGTAGCCCCAGCCCGG | 0: 1 1: 0 2: 1 3: 7 4: 103 |
||||
1007702273_1007702285 | 7 | Left | 1007702273 | 6:43772066-43772088 | CCCCGCCAGCCCTCCGCGGGAAG | 0: 1 1: 0 2: 0 3: 8 4: 114 |
||
Right | 1007702285 | 6:43772096-43772118 | CTCGAGGTAGCCCCAGCCCGGGG | 0: 1 1: 0 2: 0 3: 7 4: 115 |
||||
1007702273_1007702284 | 6 | Left | 1007702273 | 6:43772066-43772088 | CCCCGCCAGCCCTCCGCGGGAAG | 0: 1 1: 0 2: 0 3: 8 4: 114 |
||
Right | 1007702284 | 6:43772095-43772117 | TCTCGAGGTAGCCCCAGCCCGGG | 0: 1 1: 0 2: 2 3: 15 4: 170 |
||||
1007702273_1007702281 | -9 | Left | 1007702273 | 6:43772066-43772088 | CCCCGCCAGCCCTCCGCGGGAAG | 0: 1 1: 0 2: 0 3: 8 4: 114 |
||
Right | 1007702281 | 6:43772080-43772102 | CGCGGGAAGGTGACCTCTCGAGG | 0: 1 1: 0 2: 0 3: 2 4: 48 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1007702273 | Original CRISPR | CTTCCCGCGGAGGGCTGGCG GGG (reversed) | Intronic | ||