ID: 1007702741

View in Genome Browser
Species Human (GRCh38)
Location 6:43774052-43774074
Sequence CTCGACAGTGAAGCATTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007702741 Original CRISPR CTCGACAGTGAAGCATTCTG GGG Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
908131717 1:61081836-61081858 CTCTCCAGCGAAGCTTTCTGTGG - Intronic
908522807 1:64960967-64960989 CTCAAAAGTGAAACAATCTGGGG - Intronic
911370199 1:96987166-96987188 GCCGACAGTGCAGCCTTCTGTGG - Intergenic
912695408 1:111838002-111838024 CTCGACAGTGACGCGTTATGTGG - Intronic
918038880 1:180900049-180900071 TTTGAGAGTGAAGCATTCTTTGG + Intergenic
918187264 1:182139264-182139286 CTTTCCAGTGAAGCAATCTGGGG - Intergenic
921551099 1:216536621-216536643 CCTGACAATGAAGGATTCTGTGG - Intronic
1066818559 10:39454599-39454621 AACTACAGAGAAGCATTCTGAGG - Intergenic
1067570533 10:47368138-47368160 CTACAGAGTGGAGCATTCTGTGG + Exonic
1068891109 10:62149120-62149142 CTGTGCAGTGAAGCACTCTGGGG - Intergenic
1080864401 11:36180544-36180566 CCAGACAGTGAAGCCTTATGAGG + Intronic
1090546878 11:127775272-127775294 CTCAACAGTGAAACATGCTATGG - Intergenic
1094145282 12:27222187-27222209 CTCTTCAGTTAAGCAATCTGGGG - Intergenic
1094647900 12:32344917-32344939 CCCTACAGGGAAGAATTCTGTGG - Intronic
1099244665 12:80180491-80180513 CTCTGCAGTGAAGGAGTCTGTGG + Intergenic
1099724692 12:86411344-86411366 ATGGATAGTGAAGCATTCTGAGG + Intronic
1100618648 12:96250572-96250594 CTCAACAGCCAGGCATTCTGTGG + Intronic
1102515423 12:113443011-113443033 GTCTACAGTGAAGCAGCCTGGGG + Intergenic
1102766790 12:115440475-115440497 TTCCACAATGAACCATTCTGGGG + Intergenic
1106568664 13:30907469-30907491 CACAACAGTCAAGCATCCTGGGG - Intronic
1111801047 13:92981295-92981317 CTCTCCAGTAAAGAATTCTGTGG - Intergenic
1118035852 14:61865103-61865125 CTGGACTATGAAGCCTTCTGTGG + Intergenic
1119029829 14:71183294-71183316 GTCCACCCTGAAGCATTCTGTGG - Intergenic
1124594197 15:31080314-31080336 CTTGACAGTGGAGAATTCTGGGG + Intronic
1125142720 15:36428508-36428530 CTGGACACTCAAGCATACTGTGG + Intergenic
1129985950 15:79919865-79919887 CAGGGCAGTGAAGCATTCTTTGG - Intronic
1146990684 17:37268650-37268672 CAAGACAGTGAAGAATTATGGGG - Intronic
1150910888 17:69386425-69386447 CTTCACAGTGAAGCTTTCTCTGG - Intergenic
1153131922 18:1863653-1863675 CTCTACAGTGAAGCGTTGTCTGG - Intergenic
1154705917 18:17813993-17814015 CTAGACAGACAAGCATTCTCAGG + Intergenic
1160947593 19:1650979-1651001 CGCGACAGTAAAGCAATCTAGGG - Intronic
1162379807 19:10324777-10324799 CTTGACAGTGAAGCAGCTTGAGG - Intronic
1166602889 19:44113600-44113622 CTCGTCAGTGGAGCCTTCTTGGG + Intronic
1167374839 19:49105076-49105098 CTTGGCAGTGACGCATGCTGGGG + Intronic
925882069 2:8361219-8361241 CTGGAGAGTGAAGCAGGCTGGGG - Intergenic
935286942 2:101573285-101573307 CTCGCAAGTGAAGCTTTCTCAGG - Intergenic
937842629 2:126539003-126539025 CTCGAAAGGGAAGCATTCTCAGG - Intergenic
939602390 2:144208750-144208772 CTCATCATTGAAGCATTCTATGG - Exonic
941221143 2:162783081-162783103 CTCCACAGTGAAGGACTTTGTGG - Intronic
941237517 2:162993846-162993868 CATGAAAATGAAGCATTCTGGGG - Intergenic
1174497676 20:50959770-50959792 CTGGACTATGAAGCCTTCTGTGG + Exonic
1180101626 21:45590428-45590450 CTCCAGAGTGAGGCCTTCTGCGG - Intergenic
1181600898 22:23951403-23951425 CTGGACACAGAAGCAGTCTGTGG + Intergenic
1181607615 22:23989923-23989945 CTGGACACAGAAGCAGTCTGTGG - Intergenic
1182599182 22:31446662-31446684 CTGGACAGTGGAGAGTTCTGAGG + Intronic
951714916 3:25631458-25631480 CTCTGCAGTGAATCAATCTGTGG + Intronic
952618076 3:35299808-35299830 TTATACAGTGATGCATTCTGAGG + Intergenic
956835538 3:73093371-73093393 TTCGTCACTGAAGAATTCTGTGG - Intergenic
962339036 3:134565918-134565940 ACCCACAGTGAAGCATACTGTGG - Intronic
964593849 3:158398859-158398881 CTTGACAGAGAAGGAGTCTGTGG + Intronic
966801942 3:183772337-183772359 TTCAACAGTGAAGCAGGCTGTGG + Exonic
967735442 3:192946962-192946984 CTCTTCAGAGAAGCATTCTCTGG + Intergenic
969563452 4:7963834-7963856 CTAGACAGTGCAGCACCCTGAGG - Intergenic
973500513 4:51298308-51298330 ATCTAGAGAGAAGCATTCTGAGG + Intergenic
973507206 4:51408176-51408198 ATCTAGAGAGAAGCATTCTGAGG + Intergenic
973523803 4:51681006-51681028 CTCTAGAGAGAAGCATTCTCAGG + Intergenic
973927022 4:55749020-55749042 GAAGACAGTGAAGCAGTCTGTGG + Intergenic
979742982 4:124174584-124174606 CACCACATTGAAGCATTCTTAGG - Intergenic
980575295 4:134679007-134679029 CTGTACACTGTAGCATTCTGAGG + Intergenic
990519451 5:56564686-56564708 CAAGACAGTGAAGCATCCAGGGG + Intronic
992961217 5:81958143-81958165 CTGTACACTGTAGCATTCTGAGG - Intergenic
994170155 5:96650941-96650963 CTTGACACTGAAGCATTCATTGG + Intronic
996985068 5:129551268-129551290 AACAACAGTGAAGCATTCTTAGG + Intronic
1004292056 6:14376446-14376468 ATAGACCGTGAAGCCTTCTGAGG - Intergenic
1006152947 6:31998982-31999004 CTGCACAGGGAAGCATTGTGAGG - Intronic
1006159255 6:32031719-32031741 CTGCACAGGGAAGCATTGTGAGG - Intronic
1006454298 6:34123150-34123172 CTTGCCAGTGAAGCAACCTGTGG - Intronic
1007702741 6:43774052-43774074 CTCGACAGTGAAGCATTCTGGGG + Intronic
1013031692 6:106339870-106339892 AAAGACAGTGCAGCATTCTGTGG - Intergenic
1013066432 6:106688417-106688439 ATCTACAGTGAAACATTCTATGG + Intergenic
1014486615 6:122007168-122007190 ATTAACTGTGAAGCATTCTGAGG + Intergenic
1031354785 7:120777676-120777698 CTGTACATTGTAGCATTCTGAGG + Intergenic
1034235944 7:149569628-149569650 CAGGACAGTGAAGCATTCCTTGG + Intergenic
1040186377 8:44642858-44642880 CTAGACAGAGAAGCATTCTGAGG + Intergenic
1041533890 8:58904171-58904193 TTCCACTCTGAAGCATTCTGTGG - Intronic
1043548299 8:81339711-81339733 CTCAACAGTGAAGCATGAAGGGG + Intergenic
1046929084 8:119825024-119825046 GTTGTCAGTGAACCATTCTGGGG - Intronic
1053950369 9:43368658-43368680 CTCTAGAGAGAAGCATTCTCAGG + Intergenic
1053963962 9:43610007-43610029 CTAGACAGGAAAGCATTCTCAGG + Intergenic
1053974411 9:43790553-43790575 CTCTAGAGAGAAGCATTCTCAGG + Intergenic
1054017470 9:44538280-44538302 CTCTAGAGAGAAGCATTCTCAGG + Intergenic
1054019329 9:44570616-44570638 ATCTAGAGAGAAGCATTCTGAGG + Intergenic
1054040946 9:44940629-44940651 ATCTAGAGAGAAGCATTCTGAGG + Intergenic
1054053945 9:45160228-45160250 CTAGACAGAGAAACATTCTCAGG + Intergenic
1054063169 9:45318198-45318220 ATCTACAGAGAAGCATTCTCAGG + Intergenic
1054065652 9:45361222-45361244 CTCTAGAGAGAAGCATTCTCAGG + Intergenic
1054069151 9:45421087-45421109 CTAGAGAGAGAAGCATTCTCAGG + Intergenic
1054804575 9:69385462-69385484 TTCTCCAGGGAAGCATTCTGGGG - Intronic
1056096519 9:83260082-83260104 CTCCCCAGTCCAGCATTCTGTGG + Intronic
1059280160 9:113126081-113126103 CTGGACAGTGAAGATCTCTGAGG + Intergenic
1060878816 9:127103352-127103374 CTTGTCAGTGAAGCAATGTGGGG + Intronic
1061662776 9:132141382-132141404 CTCCAGAGGGAATCATTCTGGGG - Intergenic
1203593610 Un_KI270747v1:97886-97908 CTCTAGAGAGAAGCATTCTCAGG + Intergenic
1185810370 X:3103299-3103321 CACGAGAGTAAAGAATTCTGGGG + Intronic
1188101779 X:26096946-26096968 CTGGCTAGTGAAGCATTGTGAGG - Intergenic
1188503961 X:30860897-30860919 TTAGACAATGAAGCATTCAGTGG + Intronic
1189286216 X:39854231-39854253 CTGGACAGTGAAGCATCTTCAGG + Intergenic
1190527415 X:51342049-51342071 CTCTACAGTGAAGAAGTCTCAGG + Intergenic
1195431288 X:104792331-104792353 CTAGACAGTGAAGCGATCTGGGG - Intronic
1198370348 X:135983672-135983694 CTGGTCAGGGAAGCAATCTGTGG + Intergenic
1198482924 X:137057285-137057307 CTCTACAGTGAAGAACTCTTTGG + Intergenic