ID: 1007704816

View in Genome Browser
Species Human (GRCh38)
Location 6:43784136-43784158
Sequence GAAGAGGCTCCCTGCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007704816_1007704823 30 Left 1007704816 6:43784136-43784158 CCTCCTCAGCAGGGAGCCTCTTC 0: 1
1: 1
2: 0
3: 24
4: 250
Right 1007704823 6:43784189-43784211 TCAGCTCTTAAAATGTCAAGTGG 0: 1
1: 0
2: 1
3: 15
4: 211
1007704816_1007704819 0 Left 1007704816 6:43784136-43784158 CCTCCTCAGCAGGGAGCCTCTTC 0: 1
1: 1
2: 0
3: 24
4: 250
Right 1007704819 6:43784159-43784181 TGATTAACTTCATCCAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007704816 Original CRISPR GAAGAGGCTCCCTGCTGAGG AGG (reversed) Intronic
900597047 1:3484935-3484957 GAAGATACTGCCTGCTGGGGCGG + Intergenic
900873714 1:5326087-5326109 GAAGAATCTCCCAGCTGAGATGG - Intergenic
902123418 1:14187543-14187565 TGAGAGGCTCCCAGCTGAGAAGG + Intergenic
902139589 1:14341663-14341685 GGAGGGCCTCCCTGCAGAGGTGG - Intergenic
902232559 1:15037008-15037030 GAAGAGGCGCGCTGCACAGGGGG - Intronic
902671164 1:17974932-17974954 GCAGTGTCTCCATGCTGAGGAGG - Intergenic
902770117 1:18640901-18640923 GAGGGGGCTCCCGGCGGAGGGGG + Intronic
903575093 1:24334745-24334767 GAAGAGGCTCCAGGTGGAGGTGG - Intronic
904649060 1:31990637-31990659 GAAGAGACTCCAAGCAGAGGAGG - Intergenic
905655786 1:39685066-39685088 AGAGAAGCTCCCTGCTGGGGTGG - Intronic
905974070 1:42162858-42162880 AAAGAGCTTCCCTGCTGCGGAGG + Exonic
906782510 1:48585272-48585294 GATGAGGGTCCCTCCAGAGGAGG - Intronic
907167940 1:52431327-52431349 GGTTGGGCTCCCTGCTGAGGTGG + Exonic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
910012791 1:82486229-82486251 AAAGAGAGACCCTGCTGAGGGGG - Intergenic
910463588 1:87473541-87473563 GATAAGGCTCCCTGCGGAGTTGG + Intergenic
911692564 1:100850912-100850934 GAGGGGACTCCCTGATGAGGGGG + Intergenic
911947833 1:104135272-104135294 GTAGAGGGTCTGTGCTGAGGAGG - Intergenic
912537906 1:110389312-110389334 GAAGAGGCATCATGCTGAAGAGG - Exonic
915005086 1:152628419-152628441 GAGGAGGCTCTTTGATGAGGTGG - Intergenic
915244474 1:154546623-154546645 GAAGAGGGTCCCTGCTGCCCAGG + Intronic
915660834 1:157403694-157403716 CCAGAGCCTCACTGCTGAGGGGG - Intergenic
919157387 1:193784082-193784104 GAAGAAGCTTACAGCTGAGGAGG + Intergenic
921075257 1:211695437-211695459 GCACTGGCTCCCTGCTGGGGCGG - Intergenic
921803759 1:219431401-219431423 AAAGTGGCTGTCTGCTGAGGTGG + Intergenic
922822635 1:228494539-228494561 AAAGAGGCTTCCTTCTGCGGAGG - Exonic
923676341 1:236083816-236083838 GAAGAGGCTGCCTGGCCAGGAGG - Intergenic
924615886 1:245611750-245611772 GATGAGGCTGCAGGCTGAGGAGG - Intronic
1062803328 10:396023-396045 CAAGGGGCTCTCAGCTGAGGGGG + Intronic
1062849161 10:729673-729695 GTGGAAGCTCCTTGCTGAGGGGG - Intergenic
1063051815 10:2457746-2457768 GGAGAGGCACCCTGAGGAGGGGG + Intergenic
1064489554 10:15837537-15837559 GAAGAGGTTCCCTGCCAAGTAGG - Intronic
1065114899 10:22476023-22476045 GAAGAGGCTGGCGGCTGCGGCGG + Intergenic
1067941361 10:50659688-50659710 GAAGATGCTCGTTGCTGAGCAGG - Intergenic
1068314166 10:55320070-55320092 GAGGAGGCTCCAGTCTGAGGAGG - Intronic
1070556202 10:77529508-77529530 GAAGAAGCTTACAGCTGAGGTGG - Intronic
1070643725 10:78187000-78187022 GGAGAGGCTCCCTTCAAAGGGGG - Intergenic
1070704886 10:78630488-78630510 GAAGATGCTCCTTGCTGGTGGGG - Intergenic
1070729665 10:78817671-78817693 GCAGAGACTTCCTGCTGATGCGG + Intergenic
1070862600 10:79684650-79684672 GAAGATGCTCGTTGCTGAGCAGG - Intergenic
1070962917 10:80511534-80511556 GAGCAAGCTCCCTGCTAAGGAGG + Intronic
1073558648 10:104478666-104478688 GAAGAGGCTGGCTGTTGAGCTGG + Intergenic
1073919511 10:108442976-108442998 AAAGAGGTTCTCTGCTGAGTGGG - Intergenic
1074002091 10:109383628-109383650 TAAGAGTATCCCGGCTGAGGAGG - Intergenic
1075702642 10:124479143-124479165 GAGGAGGCAGCGTGCTGAGGTGG + Intronic
1077030270 11:462344-462366 GCAGGGGCTCCCTGCTGGAGAGG - Intronic
1077037283 11:501528-501550 GACGGGGCTCCCTGGTGAGGTGG - Intronic
1077217931 11:1402803-1402825 GAACAGGCCCCCAGCAGAGGAGG + Intronic
1077809713 11:5624936-5624958 GAAGTCCCTCCCTCCTGAGGAGG - Intronic
1077862879 11:6198936-6198958 GAAGAGGCTGCCTGCTGCAGTGG - Intergenic
1078198607 11:9158433-9158455 CAAGAGTCTCCAAGCTGAGGTGG + Intronic
1079082380 11:17422972-17422994 GAGGAGGCTCACTGCGGATGTGG - Intronic
1081850827 11:46274146-46274168 GAAGGGCCTCCCCGCTCAGGAGG - Intergenic
1083745581 11:64734935-64734957 GGAGAGGCTGCCAGCTGTGGAGG - Intronic
1083935018 11:65865553-65865575 GAAGAGGCTTCCTGGAGAAGGGG + Intronic
1084174764 11:67417467-67417489 GAAGAGGGCCCCTGGGGAGGGGG + Exonic
1085046908 11:73358982-73359004 TGAGAGGCAGCCTGCTGAGGAGG - Intronic
1087008874 11:93494971-93494993 GAGGAGGGTCGCTGCTGTGGTGG - Intronic
1090506505 11:127320819-127320841 GAAGAGGGGCCCTGCAGGGGTGG - Intergenic
1092199206 12:6569490-6569512 GAAGAGGCCCCCTGCGAATGAGG - Intergenic
1096581173 12:52586270-52586292 GCAGTGGCTTCCTGCTGAGATGG + Intronic
1096967846 12:55642847-55642869 GAAGTGGCTTCCAGCAGAGGAGG - Intergenic
1098309168 12:69131281-69131303 TAATAAGCTCCCTGCTGATGTGG - Intergenic
1099418056 12:82418510-82418532 GAAGAGACTAACTGCTCAGGTGG - Intronic
1099654315 12:85469466-85469488 ATAAAGGGTCCCTGCTGAGGAGG - Intergenic
1100329747 12:93571863-93571885 GAGGAGGCTGCCTGGTGCGGAGG + Exonic
1100346160 12:93733636-93733658 GGGGAGGCTGCCTGCTCAGGTGG + Intronic
1103512395 12:121484263-121484285 CAGGAGGCTCCCTGGTGAGGAGG + Intronic
1103705096 12:122867204-122867226 GAAGAGAATCCTTGCTGAGTGGG + Exonic
1106404725 13:29463667-29463689 GAAGAGGCTCTGTGGTGAAGTGG - Intronic
1106470764 13:30052322-30052344 GAGGCGGCTTCCTGGTGAGGGGG - Intergenic
1108437854 13:50418129-50418151 GATGAGGCTGCCTACTCAGGTGG + Intronic
1108715410 13:53073417-53073439 GAACAGCTTCCCTGCTGAGTGGG + Intergenic
1116454947 14:45109066-45109088 GTAGAGGGTCGCAGCTGAGGAGG - Intronic
1117902234 14:60546899-60546921 GAAGAGGCAACCTGTTGAAGGGG - Intergenic
1118312158 14:64702179-64702201 GAAGAGGCTCCGAGCTGTGGAGG + Intergenic
1120522072 14:85535146-85535168 AAAGAGCCTCCCAGCTGAGTGGG - Intronic
1124089528 15:26585141-26585163 GAAGCTGCTCCCTGGAGAGGTGG - Intronic
1124089768 15:26587605-26587627 GAAGCTGCTCCCTGGAGAGGTGG - Intronic
1126387607 15:48109980-48110002 GAGGTGGCTCCCTGCTGCTGAGG + Intergenic
1127417589 15:58771989-58772011 GAACAGGGTCCCTGAGGAGGAGG + Exonic
1128555469 15:68628842-68628864 CAAGAGGCTTTCTGCTGAGAGGG + Intronic
1128841264 15:70853560-70853582 GAAGAGGCCTCCTCCAGAGGAGG + Intronic
1128889434 15:71317694-71317716 GAAGAGGCTGCCTGTGTAGGGGG + Intronic
1129107340 15:73319140-73319162 GCAGAGGCCCCCTCCTGGGGTGG - Intergenic
1129762968 15:78142258-78142280 GATGAGGCCCTCTGCTGAGATGG + Intronic
1129845296 15:78765331-78765353 GAAGCTGCTGCCTGCTGGGGAGG + Intronic
1132335924 15:101048718-101048740 GATGAGGCATCCTGCTGACGTGG - Intronic
1133166156 16:3949201-3949223 GAGGAGTCTGCCTGCTGGGGCGG - Intergenic
1134846550 16:17445619-17445641 GAGGAGCCTCCATGCTGGGGCGG - Intronic
1140040893 16:71407049-71407071 GAAGAAGCTCTCTGCAGAGGTGG - Intergenic
1141239043 16:82248055-82248077 GAAGAGTGGCCCTGCTGAGCCGG - Intergenic
1142197396 16:88745141-88745163 GCAGTGGGTCCCTGCGGAGGTGG - Intronic
1142208075 16:88793415-88793437 GCAGAGCCTTCCTGCTGGGGTGG - Intergenic
1142217039 16:88834863-88834885 GCAGGGTGTCCCTGCTGAGGTGG - Intronic
1142408680 16:89905129-89905151 GATGAGGGTCCCTGAGGAGGGGG - Intronic
1142850318 17:2701569-2701591 GAAGAGGGTCCCTGGCGGGGTGG - Intronic
1143449021 17:7024616-7024638 GACCAGGCTCCCTGCTTGGGAGG - Exonic
1147216046 17:38899476-38899498 AAAGGAGCGCCCTGCTGAGGTGG - Intronic
1148147354 17:45374114-45374136 GGAGAGGGTCTCTGCTAAGGCGG - Intergenic
1148758767 17:49988339-49988361 GAAGAGCCTACCTTCTGAGAGGG + Intergenic
1149563872 17:57628191-57628213 GAGGAGGCTCCCTGGGGAGCTGG + Intronic
1152500694 17:80706843-80706865 GAAGATGCTCCCTGCTTGGGTGG - Intronic
1152768055 17:82151572-82151594 GAACAGGCTCCGTGCAGAGCTGG - Intronic
1156452428 18:37274444-37274466 GACGAGGCTCCCTGCGGCCGGGG + Exonic
1157533971 18:48444918-48444940 GAGGAGGCTCCCTGCAGGGGAGG - Intergenic
1159101220 18:63961540-63961562 GAAGAGCCTTCCTGCTCAGTGGG - Exonic
1160568944 18:79803685-79803707 GGGCAGGCTCCCTGCTGGGGCGG - Intergenic
1160817747 19:1043867-1043889 GATGTGGCTCCCCGGTGAGGAGG + Intronic
1163475429 19:17523288-17523310 GAGGAGGCACCCGGCTGAGCAGG + Exonic
1163557639 19:18001612-18001634 GAAGAGGGTCGCGGCCGAGGGGG - Intronic
1165171407 19:33894581-33894603 GGAAAGGCTACCTGCTGAAGAGG + Intergenic
1165403695 19:35617627-35617649 GGAGAGGTTCTCTGGTGAGGAGG + Intronic
1165523520 19:36332694-36332716 GAAAAGGGTCTGTGCTGAGGAGG - Intergenic
1165606235 19:37107148-37107170 GAAAAGGGTCTGTGCTGAGGAGG - Intronic
1167586343 19:50377741-50377763 GAAGGGGCGCCAGGCTGAGGGGG - Exonic
1167831501 19:52026627-52026649 GTAAAGGGTCTCTGCTGAGGAGG + Intronic
1168203060 19:54830608-54830630 CAAGAGGCTCCCTCTTGACGTGG + Exonic
1168251034 19:55142034-55142056 GTGGAGGGTCCCAGCTGAGGCGG + Intronic
1168296422 19:55379203-55379225 GGAGAGGGACCCTGCTGGGGTGG - Intergenic
925045603 2:771055-771077 AATGAGGCTCTCTGCTCAGGTGG - Intergenic
925135089 2:1521477-1521499 GAGGAGGGTCCCTGGGGAGGAGG - Intronic
927976624 2:27343335-27343357 GAGGAGGCTCCCTCCAGAGCAGG - Exonic
928376759 2:30781264-30781286 GAAGATGCTGCCTGCTGGTGTGG - Intronic
929995282 2:46822171-46822193 GAGAAAGCTCCCTGATGAGGAGG + Exonic
930981759 2:57534354-57534376 GAAGAGGTGGCATGCTGAGGAGG - Intergenic
932600320 2:73119738-73119760 GTAAAGGGTCTCTGCTGAGGTGG - Intronic
932824518 2:74927237-74927259 GAAGAGGAGCCCTGCGGAGCTGG - Intergenic
932840629 2:75079053-75079075 GTATAGGCTGCCTGGTGAGGTGG - Intronic
933178873 2:79207671-79207693 GAAGTGGCTCCCTGCAGAGCTGG + Intronic
934556656 2:95290085-95290107 GAAGATGCTTCCTTCTGAAGAGG - Exonic
935230769 2:101094049-101094071 GAAGAGGGCCTCTGCTGGGGAGG - Intronic
935706920 2:105865001-105865023 CAAGAGGCCTCCTGCTGGGGAGG - Intronic
935797532 2:106659225-106659247 GAAGAGGATCCATGCTGGGTGGG - Intergenic
937041561 2:118824703-118824725 GCAGAGTCTTCCTTCTGAGGAGG - Intergenic
937279949 2:120710959-120710981 GCAGCAGGTCCCTGCTGAGGAGG + Intergenic
938662571 2:133502883-133502905 GAGGTGGCTCCCTGCAGAGGAGG + Intronic
939229629 2:139409653-139409675 GAAGAGGCCCCGTGCTGAGCAGG + Intergenic
944327731 2:198426558-198426580 GAACAGGCTACCTGCAGAGTGGG - Intronic
944553153 2:200864161-200864183 GGCGAGGCTCCCCGTTGAGGGGG - Exonic
945043308 2:205760638-205760660 GAAGGGGCTACCTGGTGGGGTGG + Intronic
945866001 2:215176574-215176596 GAAGAGGCAACCTGTTGAGTGGG - Intergenic
946426615 2:219601785-219601807 GAAGAGCCTCTTTGGTGAGGAGG + Intronic
948837463 2:240632529-240632551 CAGGAGGGTCCATGCTGAGGTGG + Intergenic
1168959893 20:1861846-1861868 GCGGAGAGTCCCTGCTGAGGAGG + Intergenic
1170841905 20:19930571-19930593 GACGGGGCTTCCTGCTGGGGTGG + Intronic
1170937229 20:20820852-20820874 AATGAGGCTCCCTGGTGAGAGGG - Intergenic
1171459821 20:25292204-25292226 GAAGGGGAGCCCTGCAGAGGCGG + Intronic
1175796437 20:61774162-61774184 GCAGAGGCTGGGTGCTGAGGTGG - Intronic
1175993135 20:62799318-62799340 CAAGGGGCTCCCAGCTCAGGAGG + Intronic
1176061160 20:63173587-63173609 CAAGAGGCGCCCTGTAGAGGGGG + Intergenic
1176882651 21:14216183-14216205 GAGGATGTTCCCTGCTCAGGAGG + Exonic
1178886820 21:36491325-36491347 GAAGAGGCGCCCAGCTGGGAAGG - Intronic
1179727467 21:43348423-43348445 CAAGAGGCCCCCTACTGATGTGG - Intergenic
1180025380 21:45158187-45158209 GAGGATGCTCCCTGCTGTGCAGG - Intronic
1180156863 21:45982185-45982207 GGAGGGGCTCCCTGGCGAGGGGG + Intronic
1180605626 22:17057017-17057039 GCAGGGGCTCCCTGGTGAGGGGG - Intergenic
1180701576 22:17784230-17784252 GCAGGAGCTGCCTGCTGAGGCGG + Intergenic
1181594848 22:23907501-23907523 GTAAAGGGTCCGTGCTGAGGAGG + Intergenic
1181738665 22:24902245-24902267 GAAGAGCCTCATTGCTGAGTGGG + Intronic
1182259420 22:29062591-29062613 CAGGAGCCTCCCTCCTGAGGGGG + Intergenic
1182269098 22:29142260-29142282 GAAGAGGCACCCTGCTGCCAGGG + Intronic
1184127979 22:42501007-42501029 GAGGAGGCTGCCAGCTGTGGGGG + Intergenic
1184514959 22:44956207-44956229 GAGGAGGCTCCCTGGGGAGGGGG + Intronic
1184592794 22:45496360-45496382 GGAAAGGCTCTCTGCAGAGGTGG + Intergenic
1184646153 22:45896542-45896564 CACGAGGCTCCCTCCTGAGAAGG - Intergenic
1184942964 22:47782332-47782354 GAAGAACATCCCTGCTCAGGAGG + Intergenic
1185023023 22:48391475-48391497 AAAGAGGTTCCCTGGTGAAGAGG + Intergenic
950477205 3:13221739-13221761 GAGGCAGCTCCCTGCCGAGGAGG - Intergenic
950551686 3:13669940-13669962 GGAGAGGCGGCTTGCTGAGGAGG + Intergenic
951900865 3:27656396-27656418 GAAGAGGCTTCTTTCTGGGGAGG + Intergenic
954622663 3:52004917-52004939 CCAGTGGCTGCCTGCTGAGGGGG - Intergenic
956738992 3:72260274-72260296 ACAGAGGCTCCCTGGTGAGGTGG + Intergenic
960551129 3:118977612-118977634 CAAGATGATCCCTGCTGAGCAGG - Intronic
966043279 3:175518580-175518602 CAAGAGCCTTCCTGCTGATGGGG + Intronic
967252702 3:187559206-187559228 GAAGAGTCTCCCTCGTGAGGAGG + Intergenic
968045202 3:195620060-195620082 GAAGAGGGGCCCTGCTGGTGGGG - Intergenic
968061055 3:195726403-195726425 GAAGAGGGTCCCTGCTGGTGGGG - Exonic
968698258 4:2042891-2042913 GAAGAGGCCCCCTGCGGGAGTGG + Intronic
968936154 4:3611571-3611593 GGGGAGGCTCCCAGCTGAGCAGG + Intergenic
968965725 4:3768199-3768221 GAAGCAGCCCCTTGCTGAGGGGG - Exonic
969398629 4:6939048-6939070 GAAGAGGCCACCGGCTGAGCCGG - Intronic
970793641 4:19888652-19888674 GCTGAGGGTTCCTGCTGAGGGGG - Intergenic
975162006 4:71134943-71134965 GATGAAGCTTCCTCCTGAGGGGG + Intergenic
977296013 4:95210081-95210103 GAGAAGGCTCCCTGCTGGGCTGG + Intronic
981296434 4:143138163-143138185 GAAGAAGCTACCTCCAGAGGTGG + Intergenic
982279561 4:153669234-153669256 GGAGAAGATCCCTGCAGAGGAGG + Intergenic
984802358 4:183726818-183726840 GAAAAGGGTCTGTGCTGAGGTGG - Intergenic
985119289 4:186623600-186623622 GAAGAGACTATCTGCTGTGGAGG + Intronic
985149775 4:186934872-186934894 GAAGAGGCTCTGTCCTGATGGGG - Intergenic
985489794 5:172468-172490 GATGGAACTCCCTGCTGAGGTGG - Intronic
986029819 5:3883521-3883543 CAAGGGGCTCTCTTCTGAGGTGG - Intergenic
986652652 5:9979743-9979765 GAAAAGGCTCCATGCTGGGGAGG - Intergenic
987847951 5:23312222-23312244 GACAATGCTCCCTGCTGTGGAGG + Intergenic
987869718 5:23599771-23599793 GAACAGGCACCCTACTGAGTGGG + Intergenic
990491307 5:56305627-56305649 GATGTGGCTGTCTGCTGAGGTGG + Intergenic
990524112 5:56608012-56608034 CAGGAAGCTACCTGCTGAGGAGG + Intergenic
992104196 5:73436797-73436819 GGAGAGGCTCCGGGCTGGGGCGG - Intergenic
997355138 5:133257668-133257690 GCAAAGGGTCCTTGCTGAGGTGG + Intronic
997419004 5:133751075-133751097 GAAGAAGCTTCATGCAGAGGTGG - Intergenic
998621690 5:143801378-143801400 GAAGACGCTGACTGCTGGGGAGG + Intergenic
998881353 5:146648302-146648324 GAGGAGGCTGCCTGCTGATGGGG + Intronic
999135531 5:149316285-149316307 GAGGAGGTTCCCTGCTGTGGTGG + Exonic
999414280 5:151381213-151381235 GATGAGGCTCATTCCTGAGGAGG - Intergenic
1000963927 5:167632187-167632209 GTAGAGGCTTCCTGTTGAGTTGG + Intronic
1001084000 5:168687185-168687207 GGAGAGGCCACCTGCTGAGGGGG - Intronic
1002423708 5:179163892-179163914 GAGGAGACTCCCTGAGGAGGGGG + Intronic
1006653419 6:35569769-35569791 CAAGAGGCTGCCTTCAGAGGAGG + Intergenic
1006829285 6:36959026-36959048 CAAGAGTCACCCTGCTAAGGAGG + Intronic
1007375063 6:41450971-41450993 AAAGAGGCTTGCTGCTGGGGTGG + Intergenic
1007704816 6:43784136-43784158 GAAGAGGCTCCCTGCTGAGGAGG - Intronic
1007709261 6:43811471-43811493 GAACAAGGTCCCTGCTGAGTGGG - Intergenic
1007745834 6:44042488-44042510 CAAGAGGCTCCCTGGTGACCAGG + Intergenic
1009050615 6:58271383-58271405 GAAGTGACTACCTGCTTAGGTGG + Intergenic
1011807012 6:91083372-91083394 GCAGATGTTCCCTGCTGAGCTGG + Intergenic
1012996045 6:105975811-105975833 GAAGTGGGTCCCAGGTGAGGTGG + Intergenic
1013884138 6:114941273-114941295 ACAAAGGCTCCCTGCTGAGGTGG - Intergenic
1014266552 6:119284347-119284369 GAAGGGTCTTCCTGCTGAGGGGG + Intronic
1014492754 6:122082450-122082472 GAAGTAGCTCTCTGCTGAGGGGG + Intergenic
1015107760 6:129556744-129556766 GAAGAGGCTTCTTTCTGTGGGGG - Intergenic
1016247449 6:142000258-142000280 GAAGAGGCACCCTGATGAATGGG + Intergenic
1016738040 6:147501402-147501424 GAAGAGGAGCCCTTCTGAGCTGG - Intergenic
1016979752 6:149843420-149843442 GATGAGTCCCCCTGCTGAGACGG - Intronic
1018153221 6:160960187-160960209 AATGAAGCTCCCTGCTGGGGAGG - Intergenic
1019550521 7:1599964-1599986 GCAGGGCCTCCCTGGTGAGGCGG + Intergenic
1019714448 7:2531927-2531949 GAAGAGGGTCCCCACGGAGGGGG + Intergenic
1022172282 7:27841728-27841750 AAAGAGGCTGCCTGTTGAAGTGG - Intronic
1022442566 7:30446288-30446310 GAAGGGGCTCTGTGCTGGGGAGG - Intronic
1022532699 7:31076807-31076829 GATGGGGGGCCCTGCTGAGGGGG + Intronic
1022590014 7:31652665-31652687 CAGGAGGCTCCCTGTTCAGGTGG + Exonic
1022957893 7:35398402-35398424 GAAGGGGCCACCTGCAGAGGTGG - Intergenic
1023965956 7:44963188-44963210 GCAGAGGCTTCCTGGGGAGGGGG - Intronic
1029127945 7:98308119-98308141 GAAGAGGATCCCTGCGGCTGCGG + Intronic
1029959953 7:104680234-104680256 AGGGAGGTTCCCTGCTGAGGAGG - Intronic
1032478263 7:132226942-132226964 GCAGAGGCTCCATGCTGGTGAGG - Intronic
1034415017 7:150959726-150959748 GAAGCAGCTCCCTGCAGAGTGGG + Exonic
1035831214 8:2696714-2696736 GAAGAGGATGCTTGCTGAGCTGG - Intergenic
1036746740 8:11415293-11415315 AAAAAGGCCCCCTGCTGAGCTGG + Intronic
1040027609 8:42796222-42796244 GTAAAGGGTCTCTGCTGAGGAGG - Intronic
1040483499 8:47848980-47849002 GAATAGGATATCTGCTGAGGTGG - Intronic
1040563648 8:48546552-48546574 GAAGGGGCACAGTGCTGAGGTGG - Intergenic
1042229399 8:66541405-66541427 GCAGAGGGTCCCTGCTGTCGGGG - Intergenic
1043336244 8:79180297-79180319 GCAGAGGCTTGCTGCTGGGGTGG - Intergenic
1043714048 8:83459371-83459393 GTAGAGGCTCCCTGTTGCTGTGG - Intergenic
1046184508 8:110694959-110694981 GAAGAACCTCCCTGCTGTGCAGG - Intergenic
1046552083 8:115730608-115730630 GAAGGGGCTGCCTGCTGAGATGG - Intronic
1046598015 8:116284194-116284216 GCAGAGAACCCCTGCTGAGGTGG - Intergenic
1047765487 8:127986663-127986685 GAAGTGACCCCCTGCTGAGCAGG + Intergenic
1049831741 8:144705231-144705253 CAAGGGGCTCCAGGCTGAGGGGG - Intergenic
1054340540 9:63858117-63858139 GAAGAGATTTCCTTCTGAGGTGG + Intergenic
1054454136 9:65420870-65420892 GGGGAGGCTCCCAGCTGAGCGGG - Intergenic
1056767943 9:89456248-89456270 GGAGAGGCTCTCTGCTAAGTTGG - Intronic
1057080761 9:92172852-92172874 GCAGATGCTCCTTGCTGAGCAGG - Intergenic
1060015225 9:120080957-120080979 TAAAGGGCTCCCTGCTGTGGGGG - Intergenic
1060839266 9:126781387-126781409 CAAGAGGCTCCCAGGTGATGGGG + Intergenic
1061732964 9:132630852-132630874 GAAGGGGCTCCCTGCTCTGTGGG + Intronic
1061872131 9:133526781-133526803 GAAGTGCCTCCCTGCAGGGGAGG - Intronic
1062159283 9:135070752-135070774 GCAGAGGCTCCATGTAGAGGTGG - Intergenic
1062213571 9:135377430-135377452 GAAGAGACCCTCTGGTGAGGGGG - Intergenic
1062289121 9:135786716-135786738 GCAGAGGCCCCGTGCAGAGGAGG + Intronic
1062321355 9:135991995-135992017 GAAGAGGCTCCCTGCTGGGGCGG + Intergenic
1062438382 9:136557176-136557198 GCAGAGGTTCCCTGCTCGGGAGG - Intergenic
1062479948 9:136746567-136746589 CAAGGGGCTCCAGGCTGAGGTGG - Intronic
1187415274 X:19087701-19087723 GGAGGGGCTGCATGCTGAGGTGG + Intronic
1188682030 X:33020948-33020970 GAAGAGGTTTCCTGATGAGCAGG + Intronic
1189707501 X:43773440-43773462 GGACAGCCTCCCTGCTGAGAAGG - Intronic
1190566122 X:51732127-51732149 GAAGTGGCTCTCAGCTGAAGGGG - Intergenic
1192098077 X:68234375-68234397 CATGAGGTTCCCTGCTGAGACGG + Intronic
1193170369 X:78329054-78329076 GTAAAGGGTCTCTGCTGAGGAGG + Intergenic
1193537731 X:82734102-82734124 GAAGAGGCTCTCTTCTGATGCGG - Intergenic
1197163127 X:123345778-123345800 GAAGAGGTTTCCTGCTGCTGTGG - Intronic
1197523669 X:127533165-127533187 GAAGAGGCAACCTGCTGAATGGG + Intergenic
1198331234 X:135624950-135624972 GAAGCTGCTTCCTGCTGAGTGGG + Intergenic
1198335105 X:135658178-135658200 GAAGCTGCTTCCTGCTGAGTGGG - Intergenic
1198363774 X:135921143-135921165 GAAGCTGCTTCCTGCTGAGTGGG + Intergenic
1200090532 X:153633861-153633883 CAAGAAGCAACCTGCTGAGGGGG + Intergenic