ID: 1007706506

View in Genome Browser
Species Human (GRCh38)
Location 6:43794518-43794540
Sequence TGTCGTCGTGATTTGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007706504_1007706506 -5 Left 1007706504 6:43794500-43794522 CCGATAAAGGTTAGCTATTGTCG No data
Right 1007706506 6:43794518-43794540 TGTCGTCGTGATTTGGCACAAGG No data
1007706503_1007706506 -4 Left 1007706503 6:43794499-43794521 CCCGATAAAGGTTAGCTATTGTC No data
Right 1007706506 6:43794518-43794540 TGTCGTCGTGATTTGGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007706506 Original CRISPR TGTCGTCGTGATTTGGCACA AGG Intergenic
No off target data available for this crispr