ID: 1007707941

View in Genome Browser
Species Human (GRCh38)
Location 6:43802679-43802701
Sequence AACACTGATATGTTCAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007707941_1007707944 -9 Left 1007707941 6:43802679-43802701 CCTTCCTTGAACATATCAGTGTT No data
Right 1007707944 6:43802693-43802715 ATCAGTGTTGTGTCCGCTTAGGG No data
1007707941_1007707943 -10 Left 1007707941 6:43802679-43802701 CCTTCCTTGAACATATCAGTGTT No data
Right 1007707943 6:43802692-43802714 TATCAGTGTTGTGTCCGCTTAGG No data
1007707941_1007707946 20 Left 1007707941 6:43802679-43802701 CCTTCCTTGAACATATCAGTGTT No data
Right 1007707946 6:43802722-43802744 TACTTGCTGTTCCCTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007707941 Original CRISPR AACACTGATATGTTCAAGGA AGG (reversed) Intergenic
No off target data available for this crispr