ID: 1007708895

View in Genome Browser
Species Human (GRCh38)
Location 6:43808836-43808858
Sequence CTTGGGTTGCCTCCAGCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007708889_1007708895 -2 Left 1007708889 6:43808815-43808837 CCTTTTATCTATTGATGGACCCT No data
Right 1007708895 6:43808836-43808858 CTTGGGTTGCCTCCAGCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007708895 Original CRISPR CTTGGGTTGCCTCCAGCTTC GGG Intergenic
No off target data available for this crispr