ID: 1007711632

View in Genome Browser
Species Human (GRCh38)
Location 6:43827938-43827960
Sequence GAGGCACCCTACCATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007711619_1007711632 2 Left 1007711619 6:43827913-43827935 CCCCTACCCCACCTCCATCCAGC No data
Right 1007711632 6:43827938-43827960 GAGGCACCCTACCATGAGGGTGG No data
1007711626_1007711632 -6 Left 1007711626 6:43827921-43827943 CCACCTCCATCCAGCTGGAGGCA No data
Right 1007711632 6:43827938-43827960 GAGGCACCCTACCATGAGGGTGG No data
1007711618_1007711632 23 Left 1007711618 6:43827892-43827914 CCTCAGAGGGAGCATCAGCAGCC No data
Right 1007711632 6:43827938-43827960 GAGGCACCCTACCATGAGGGTGG No data
1007711621_1007711632 0 Left 1007711621 6:43827915-43827937 CCTACCCCACCTCCATCCAGCTG No data
Right 1007711632 6:43827938-43827960 GAGGCACCCTACCATGAGGGTGG No data
1007711625_1007711632 -5 Left 1007711625 6:43827920-43827942 CCCACCTCCATCCAGCTGGAGGC No data
Right 1007711632 6:43827938-43827960 GAGGCACCCTACCATGAGGGTGG No data
1007711627_1007711632 -9 Left 1007711627 6:43827924-43827946 CCTCCATCCAGCTGGAGGCACCC No data
Right 1007711632 6:43827938-43827960 GAGGCACCCTACCATGAGGGTGG No data
1007711620_1007711632 1 Left 1007711620 6:43827914-43827936 CCCTACCCCACCTCCATCCAGCT No data
Right 1007711632 6:43827938-43827960 GAGGCACCCTACCATGAGGGTGG No data
1007711623_1007711632 -4 Left 1007711623 6:43827919-43827941 CCCCACCTCCATCCAGCTGGAGG No data
Right 1007711632 6:43827938-43827960 GAGGCACCCTACCATGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007711632 Original CRISPR GAGGCACCCTACCATGAGGG TGG Intergenic
No off target data available for this crispr