ID: 1007713243

View in Genome Browser
Species Human (GRCh38)
Location 6:43838202-43838224
Sequence CTGTAGGACAGGTGGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007713231_1007713243 -7 Left 1007713231 6:43838186-43838208 CCATCCCCATACTAACCTGTAGG No data
Right 1007713243 6:43838202-43838224 CTGTAGGACAGGTGGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007713243 Original CRISPR CTGTAGGACAGGTGGGGGAT GGG Intergenic
No off target data available for this crispr