ID: 1007717320

View in Genome Browser
Species Human (GRCh38)
Location 6:43864832-43864854
Sequence ATGGTAACTCAGGTGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007717314_1007717320 1 Left 1007717314 6:43864808-43864830 CCTTTAAGTGCCTGCAGTATGGT No data
Right 1007717320 6:43864832-43864854 ATGGTAACTCAGGTGGAACTGGG No data
1007717316_1007717320 -9 Left 1007717316 6:43864818-43864840 CCTGCAGTATGGTAATGGTAACT No data
Right 1007717320 6:43864832-43864854 ATGGTAACTCAGGTGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007717320 Original CRISPR ATGGTAACTCAGGTGGAACT GGG Intergenic
No off target data available for this crispr