ID: 1007722106

View in Genome Browser
Species Human (GRCh38)
Location 6:43891145-43891167
Sequence CGGTGAAGAGGAGATGGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007722106_1007722115 29 Left 1007722106 6:43891145-43891167 CCTCATCCATCTCCTCTTCACCG No data
Right 1007722115 6:43891197-43891219 TCTCTGCTCCTCTTAAGGCTGGG No data
1007722106_1007722113 24 Left 1007722106 6:43891145-43891167 CCTCATCCATCTCCTCTTCACCG No data
Right 1007722113 6:43891192-43891214 CTGCTTCTCTGCTCCTCTTAAGG No data
1007722106_1007722114 28 Left 1007722106 6:43891145-43891167 CCTCATCCATCTCCTCTTCACCG No data
Right 1007722114 6:43891196-43891218 TTCTCTGCTCCTCTTAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007722106 Original CRISPR CGGTGAAGAGGAGATGGATG AGG (reversed) Intergenic
No off target data available for this crispr