ID: 1007722109

View in Genome Browser
Species Human (GRCh38)
Location 6:43891165-43891187
Sequence GGGAACAGGCAAAGACAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007722109_1007722114 8 Left 1007722109 6:43891165-43891187 CCGTCTTGTCTTTGCCTGTTCCC No data
Right 1007722114 6:43891196-43891218 TTCTCTGCTCCTCTTAAGGCTGG No data
1007722109_1007722115 9 Left 1007722109 6:43891165-43891187 CCGTCTTGTCTTTGCCTGTTCCC No data
Right 1007722115 6:43891197-43891219 TCTCTGCTCCTCTTAAGGCTGGG No data
1007722109_1007722113 4 Left 1007722109 6:43891165-43891187 CCGTCTTGTCTTTGCCTGTTCCC No data
Right 1007722113 6:43891192-43891214 CTGCTTCTCTGCTCCTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007722109 Original CRISPR GGGAACAGGCAAAGACAAGA CGG (reversed) Intergenic
No off target data available for this crispr