ID: 1007722114

View in Genome Browser
Species Human (GRCh38)
Location 6:43891196-43891218
Sequence TTCTCTGCTCCTCTTAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007722110_1007722114 -6 Left 1007722110 6:43891179-43891201 CCTGTTCCCTTTTCTGCTTCTCT No data
Right 1007722114 6:43891196-43891218 TTCTCTGCTCCTCTTAAGGCTGG No data
1007722108_1007722114 16 Left 1007722108 6:43891157-43891179 CCTCTTCACCGTCTTGTCTTTGC No data
Right 1007722114 6:43891196-43891218 TTCTCTGCTCCTCTTAAGGCTGG No data
1007722109_1007722114 8 Left 1007722109 6:43891165-43891187 CCGTCTTGTCTTTGCCTGTTCCC No data
Right 1007722114 6:43891196-43891218 TTCTCTGCTCCTCTTAAGGCTGG No data
1007722107_1007722114 22 Left 1007722107 6:43891151-43891173 CCATCTCCTCTTCACCGTCTTGT No data
Right 1007722114 6:43891196-43891218 TTCTCTGCTCCTCTTAAGGCTGG No data
1007722106_1007722114 28 Left 1007722106 6:43891145-43891167 CCTCATCCATCTCCTCTTCACCG No data
Right 1007722114 6:43891196-43891218 TTCTCTGCTCCTCTTAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007722114 Original CRISPR TTCTCTGCTCCTCTTAAGGC TGG Intergenic
No off target data available for this crispr