ID: 1007723263

View in Genome Browser
Species Human (GRCh38)
Location 6:43898742-43898764
Sequence TTGACTCTACATACCCATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007723258_1007723263 21 Left 1007723258 6:43898698-43898720 CCTGTTTAAGCTTCTGTATTTTA No data
Right 1007723263 6:43898742-43898764 TTGACTCTACATACCCATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007723263 Original CRISPR TTGACTCTACATACCCATCA CGG Intergenic
No off target data available for this crispr