ID: 1007727187

View in Genome Browser
Species Human (GRCh38)
Location 6:43923696-43923718
Sequence GGTCTGGGAGTGGCCCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007727176_1007727187 27 Left 1007727176 6:43923646-43923668 CCCTGCCTAGTTCTGGGTACCTG No data
Right 1007727187 6:43923696-43923718 GGTCTGGGAGTGGCCCAGCCAGG No data
1007727178_1007727187 22 Left 1007727178 6:43923651-43923673 CCTAGTTCTGGGTACCTGCAGAC No data
Right 1007727187 6:43923696-43923718 GGTCTGGGAGTGGCCCAGCCAGG No data
1007727177_1007727187 26 Left 1007727177 6:43923647-43923669 CCTGCCTAGTTCTGGGTACCTGC No data
Right 1007727187 6:43923696-43923718 GGTCTGGGAGTGGCCCAGCCAGG No data
1007727181_1007727187 8 Left 1007727181 6:43923665-43923687 CCTGCAGACGTGGGCTCTCTTGC No data
Right 1007727187 6:43923696-43923718 GGTCTGGGAGTGGCCCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007727187 Original CRISPR GGTCTGGGAGTGGCCCAGCC AGG Intergenic
No off target data available for this crispr