ID: 1007730266

View in Genome Browser
Species Human (GRCh38)
Location 6:43941266-43941288
Sequence AGGGCCCTTCTCCTGGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007730257_1007730266 3 Left 1007730257 6:43941240-43941262 CCCAAGCGTGGGAACCCGTTGGC No data
Right 1007730266 6:43941266-43941288 AGGGCCCTTCTCCTGGGATCTGG No data
1007730258_1007730266 2 Left 1007730258 6:43941241-43941263 CCAAGCGTGGGAACCCGTTGGCC No data
Right 1007730266 6:43941266-43941288 AGGGCCCTTCTCCTGGGATCTGG No data
1007730253_1007730266 20 Left 1007730253 6:43941223-43941245 CCTGTGGGCACGGGTGGCCCAAG No data
Right 1007730266 6:43941266-43941288 AGGGCCCTTCTCCTGGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007730266 Original CRISPR AGGGCCCTTCTCCTGGGATC TGG Intergenic
No off target data available for this crispr