ID: 1007730523

View in Genome Browser
Species Human (GRCh38)
Location 6:43942716-43942738
Sequence CCAGCAAGTGAGATGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007730514_1007730523 26 Left 1007730514 6:43942667-43942689 CCATGTTTTACAGACAGGAAACT No data
Right 1007730523 6:43942716-43942738 CCAGCAAGTGAGATGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007730523 Original CRISPR CCAGCAAGTGAGATGGAGCC AGG Intergenic
No off target data available for this crispr