ID: 1007730751

View in Genome Browser
Species Human (GRCh38)
Location 6:43944122-43944144
Sequence CATGGAGAGCAGAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007730751_1007730758 5 Left 1007730751 6:43944122-43944144 CCTTCCTCTCTCTGCTCTCCATG No data
Right 1007730758 6:43944150-43944172 GTCATCTCCGCAGGGCAGCAGGG No data
1007730751_1007730756 -3 Left 1007730751 6:43944122-43944144 CCTTCCTCTCTCTGCTCTCCATG No data
Right 1007730756 6:43944142-43944164 ATGAAGTGGTCATCTCCGCAGGG No data
1007730751_1007730755 -4 Left 1007730751 6:43944122-43944144 CCTTCCTCTCTCTGCTCTCCATG No data
Right 1007730755 6:43944141-43944163 CATGAAGTGGTCATCTCCGCAGG No data
1007730751_1007730757 4 Left 1007730751 6:43944122-43944144 CCTTCCTCTCTCTGCTCTCCATG No data
Right 1007730757 6:43944149-43944171 GGTCATCTCCGCAGGGCAGCAGG No data
1007730751_1007730760 24 Left 1007730751 6:43944122-43944144 CCTTCCTCTCTCTGCTCTCCATG No data
Right 1007730760 6:43944169-43944191 AGGGAATATCATTCTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007730751 Original CRISPR CATGGAGAGCAGAGAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr