ID: 1007736114

View in Genome Browser
Species Human (GRCh38)
Location 6:43983307-43983329
Sequence CACTGTGAGCAGAGGGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007736114_1007736127 4 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736127 6:43983334-43983356 TGGAGGCCTGGCCTGGGGGTGGG No data
1007736114_1007736120 -3 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736120 6:43983327-43983349 GTGACCCTGGAGGCCTGGCCTGG No data
1007736114_1007736132 14 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736132 6:43983344-43983366 GCCTGGGGGTGGGAAGGGCTGGG No data
1007736114_1007736135 30 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736135 6:43983360-43983382 GGCTGGGATCGGAGCTGCACAGG No data
1007736114_1007736129 9 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736129 6:43983339-43983361 GCCTGGCCTGGGGGTGGGAAGGG No data
1007736114_1007736123 0 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736123 6:43983330-43983352 ACCCTGGAGGCCTGGCCTGGGGG No data
1007736114_1007736121 -2 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736121 6:43983328-43983350 TGACCCTGGAGGCCTGGCCTGGG No data
1007736114_1007736134 19 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736134 6:43983349-43983371 GGGGTGGGAAGGGCTGGGATCGG No data
1007736114_1007736122 -1 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736122 6:43983329-43983351 GACCCTGGAGGCCTGGCCTGGGG No data
1007736114_1007736126 3 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736126 6:43983333-43983355 CTGGAGGCCTGGCCTGGGGGTGG No data
1007736114_1007736131 13 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736131 6:43983343-43983365 GGCCTGGGGGTGGGAAGGGCTGG No data
1007736114_1007736119 -8 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736119 6:43983322-43983344 TCACAGTGACCCTGGAGGCCTGG No data
1007736114_1007736128 8 Left 1007736114 6:43983307-43983329 CCTGAGTCCCTCTGCTCACAGTG No data
Right 1007736128 6:43983338-43983360 GGCCTGGCCTGGGGGTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007736114 Original CRISPR CACTGTGAGCAGAGGGACTC AGG (reversed) Intergenic
No off target data available for this crispr