ID: 1007737096

View in Genome Browser
Species Human (GRCh38)
Location 6:43988365-43988387
Sequence CAGGGGAGCCCCTTATCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007737096_1007737103 9 Left 1007737096 6:43988365-43988387 CCAGGAGATAAGGGGCTCCCCTG No data
Right 1007737103 6:43988397-43988419 CACAGCTTCTAGCACCCCACAGG No data
1007737096_1007737104 10 Left 1007737096 6:43988365-43988387 CCAGGAGATAAGGGGCTCCCCTG No data
Right 1007737104 6:43988398-43988420 ACAGCTTCTAGCACCCCACAGGG No data
1007737096_1007737105 18 Left 1007737096 6:43988365-43988387 CCAGGAGATAAGGGGCTCCCCTG No data
Right 1007737105 6:43988406-43988428 TAGCACCCCACAGGGTCCCTCGG No data
1007737096_1007737106 19 Left 1007737096 6:43988365-43988387 CCAGGAGATAAGGGGCTCCCCTG No data
Right 1007737106 6:43988407-43988429 AGCACCCCACAGGGTCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007737096 Original CRISPR CAGGGGAGCCCCTTATCTCC TGG (reversed) Intergenic
No off target data available for this crispr