ID: 1007739187

View in Genome Browser
Species Human (GRCh38)
Location 6:44000719-44000741
Sequence CAGTCAAAGGAGAAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 519}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007739179_1007739187 12 Left 1007739179 6:44000684-44000706 CCTGCATTCTGCGGAGGGTGAGA 0: 1
1: 0
2: 1
3: 8
4: 157
Right 1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG 0: 1
1: 0
2: 4
3: 51
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007739187 Original CRISPR CAGTCAAAGGAGAAGGGGGC AGG Intronic
900008941 1:88704-88726 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
900008974 1:88850-88872 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
900008991 1:88921-88943 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
900555797 1:3279755-3279777 CAGGCAATGGGGAAAGGGGCAGG - Intronic
900760316 1:4466123-4466145 AAGTGAAAGGTGAAGGGTGCAGG + Intergenic
900875821 1:5341780-5341802 CAGGCACAGGAGAGAGGGGCTGG + Intergenic
902837046 1:19054086-19054108 CAGTTAAAGGGGAGGGTGGCCGG - Intergenic
903414972 1:23176359-23176381 AAGTCAAGGAAGTAGGGGGCTGG - Intronic
903646064 1:24897178-24897200 CTGTCAAATGGGACGGGGGCAGG - Intergenic
903926812 1:26836263-26836285 GAGACAAAGGAGATGGGGTCTGG - Intronic
903934090 1:26882866-26882888 CAGGAAAAGGAGGAGGGAGCAGG - Intronic
904055115 1:27664949-27664971 GGGTGAAAGGAGATGGGGGCGGG + Intergenic
904779814 1:32937413-32937435 CACTCAAATGAGATGGAGGCTGG + Intronic
904910019 1:33927767-33927789 CAGGCAGAAGAGAAGGGAGCAGG - Intronic
905353397 1:37363240-37363262 GAGGCAAAGGAGGATGGGGCGGG - Intergenic
907192258 1:52659349-52659371 CAGTAAATGGACAAGGGTGCTGG - Intronic
909591262 1:77351807-77351829 AAGACAAAGGAGAAAGGAGCTGG + Intronic
911126169 1:94343130-94343152 CACTCCAAAGAGAAGGGAGCGGG - Intergenic
911167405 1:94736158-94736180 CAGCCACAGGAGAATGGGGGTGG - Intergenic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
912053769 1:105568609-105568631 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
912776736 1:112510263-112510285 CCATCCAAGGAGTAGGGGGCAGG - Intronic
912939481 1:114032359-114032381 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
913141193 1:115942933-115942955 CAGCCAAGGGAGGAGGGTGCTGG - Intergenic
913451575 1:118996394-118996416 CAGCAAAAGGATAATGGGGCAGG + Intergenic
914437417 1:147671987-147672009 CAGTCACAGGATGAGGGGGGAGG + Intergenic
914833672 1:151189918-151189940 CGGACAAAGAAGAAGAGGGCGGG - Intronic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
914938748 1:152003640-152003662 TGATCAAAGGAGAAGGAGGCTGG - Intergenic
915231125 1:154446055-154446077 AAGACAAAGAAGATGGGGGCAGG - Intronic
915723081 1:157998236-157998258 CTGGCAAAGGAGAAGGGTGCAGG - Intronic
916033641 1:160901603-160901625 CCTCCAAAGGAGAAGGGTGCAGG - Intergenic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916915196 1:169399222-169399244 GAGGCAAGGTAGAAGGGGGCTGG + Intronic
918212885 1:182367236-182367258 CAGTCAAAGGAGGAGAAGCCAGG + Intergenic
918301024 1:183203992-183204014 CATTTAAAGGACAATGGGGCAGG + Intronic
918434836 1:184500716-184500738 CAGTTAAAGGAGAAGGAGCTGGG + Intronic
919897140 1:202015940-202015962 CATTCACAGGAGAAAGGAGCTGG - Exonic
921131225 1:212221695-212221717 AAGACAATGGAGAAGGTGGCTGG + Intergenic
922145753 1:222942543-222942565 CACTGAAAGGAGAGGTGGGCAGG + Intronic
922226848 1:223652871-223652893 CTGCCAATGGAGAAGGAGGCTGG - Intronic
922801539 1:228366897-228366919 CAGTCCAGGGGAAAGGGGGCTGG - Intronic
923043939 1:230340957-230340979 ATGTCACAGGAGAAGGGGACAGG + Intronic
923429119 1:233904528-233904550 GAGTCAAAAGAGAAGGGTGGAGG + Intergenic
924260438 1:242224611-242224633 CAGTAACAGGACAAAGGGGCTGG - Intronic
1063509972 10:6635194-6635216 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1063527204 10:6797184-6797206 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1063721679 10:8588658-8588680 CCGGCAAAGGAGAAAGAGGCAGG + Intergenic
1065031382 10:21589909-21589931 CAGACAAAGGGGAAGGGGAAGGG - Intronic
1065263776 10:23954266-23954288 CAATGAAAGGGAAAGGGGGCCGG + Intronic
1065540668 10:26763524-26763546 CAGTCAAAGGATCAGGGTGAAGG - Intronic
1065892287 10:30131687-30131709 CAGACAAAGTGGAAGAGGGCAGG - Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066782144 10:38963069-38963091 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1066954973 10:42157561-42157583 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1067004183 10:42645769-42645791 CAGTCACAGGAGCAGTGCGCTGG + Intergenic
1067039263 10:42940303-42940325 GAGTCCAAGGAGAAGGGAGATGG - Intergenic
1068533842 10:58218071-58218093 TAGTCAAAGAAGAAGAGAGCAGG + Intronic
1069694400 10:70376213-70376235 CAGTCAAAGGACAAGCAGGCAGG + Intronic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1070120400 10:73570839-73570861 CACTCAAAGTAGAAGCAGGCTGG + Intronic
1070659339 10:78293550-78293572 CAGTCAAAGGGGGAGGGGGTGGG - Intergenic
1070712651 10:78693929-78693951 GAGTCAGGGGAGAAGGAGGCTGG + Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1072770238 10:98131906-98131928 TAGTCAAGGGAGAAGGGAGAGGG + Intergenic
1073443653 10:103568166-103568188 CAGACAAAGGAGGTGGGGCCAGG - Intronic
1073779220 10:106818826-106818848 TTGTCAAAGGAGAAGGGGAAAGG - Intronic
1073879886 10:107968509-107968531 CAGTCAGAGGAGAACAGGGAAGG - Intergenic
1074122211 10:110501189-110501211 CAGTCAAGAGAGAATGAGGCAGG - Intronic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075246933 10:120830824-120830846 CAGTCAGCAGAGAAGGGAGCTGG + Intergenic
1075305744 10:121365811-121365833 GAGCCAAAGGAGCAGGGGGTGGG - Intergenic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1076466641 10:130687361-130687383 CAGTCAAAGGCTGAGGAGGCAGG + Intergenic
1077344343 11:2039463-2039485 CAGGCAAAGGCGAAGGCCGCAGG - Intergenic
1078670646 11:13362041-13362063 CAGGCAAGAGAGAAGGGGCCTGG + Intronic
1078824966 11:14920760-14920782 CAGGCAAAGGAAAAAGGGGAGGG - Intronic
1079283597 11:19109348-19109370 CAGTGAAAGGAGCACCGGGCTGG - Intergenic
1079487476 11:20950514-20950536 GACTCACAGGAGAAGGGGGTTGG + Intronic
1081441690 11:43087780-43087802 GAGTTAAAGGGGAAGGGGGTGGG + Intergenic
1081793883 11:45806449-45806471 CAGTCATAGGAGAAAGAGCCTGG + Intronic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1082085072 11:48043586-48043608 CGGTCAAAGCAGAAGAGGGAAGG + Intronic
1082912818 11:58395971-58395993 CACTGAAAGGAGATGGGGGTGGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084557531 11:69883826-69883848 CAGACACAGGAGCAGGGAGCTGG + Intergenic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085579783 11:77639911-77639933 CAGTCCCAGGAGATGGGGACGGG - Intergenic
1086734847 11:90293766-90293788 CAGTCAAAGCACAAGCAGGCTGG - Intergenic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1087698063 11:101403540-101403562 CAGCCTAAGGAGGAGGGGACAGG + Intergenic
1088021133 11:105120982-105121004 CAGTCAAAGGATAAGATGACAGG - Intergenic
1088732207 11:112693644-112693666 CAGTCACAGGGGTGGGGGGCAGG - Intergenic
1088968814 11:114753108-114753130 TAGTGAAAGGTGAAGTGGGCTGG + Intergenic
1089292296 11:117444545-117444567 CCGTCCAGGGAGGAGGGGGCGGG + Intronic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1091140671 11:133231832-133231854 TTGTCAAAGGAGAAGGGGCAAGG + Intronic
1202827329 11_KI270721v1_random:94652-94674 CAGGCAAAGGCGAAGGCCGCAGG - Intergenic
1092060736 12:5548331-5548353 CAGGCAAAGCAGCAGGGGGTTGG + Intronic
1092127407 12:6084634-6084656 CTGACAAAGGAGAAGGGAGGGGG + Intronic
1094018887 12:25893350-25893372 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1094129210 12:27056645-27056667 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1094173725 12:27521292-27521314 CAGCCACAGGAGATGGGGGAGGG - Intergenic
1096038112 12:48490770-48490792 CAGTCAGAGATGATGGGGGCTGG - Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1097208207 12:57342310-57342332 CATTCAAGGGTGAAGGGGGCGGG - Intronic
1097248043 12:57617350-57617372 TGGTGAAAGGAGAAGGGGACAGG + Intronic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1098305596 12:69099467-69099489 GAGGCAGAGAAGAAGGGGGCGGG + Intergenic
1098772765 12:74575404-74575426 CAGTCATAGCAGAAGGGGAAGGG - Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101827943 12:108235308-108235330 TAGTCAAAGGCAAAGGGGGTTGG + Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102454658 12:113064030-113064052 CTCTCAAGGGAGAAGGGGGAAGG - Intronic
1102675588 12:114656265-114656287 CAGTCAGGGCAGCAGGGGGCTGG - Intergenic
1103286071 12:119802867-119802889 CGGTCAAAGGAGAAATGTGCAGG - Intronic
1103949467 12:124543113-124543135 CAGACCAAGGCCAAGGGGGCTGG + Intronic
1104512994 12:129398569-129398591 CAGGCAAAGGAGGAGGGGGTTGG + Intronic
1105939774 13:25137373-25137395 CAGTCAAAGGAGAATGCTGATGG + Intergenic
1106145986 13:27050328-27050350 CAGTCAAAGGTGTTGGGAGCAGG - Intergenic
1106367024 13:29091229-29091251 CAAACAAAAGAGAAAGGGGCAGG - Intronic
1106466233 13:30016813-30016835 GAGGCAAAGGAGATGGGGGAGGG - Intergenic
1106538154 13:30666178-30666200 CAGCCAAAGGAGCAGGGGCAGGG + Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1107971907 13:45651256-45651278 CAGTCAAGGGAAAAGGAGGTTGG - Intergenic
1108215810 13:48183267-48183289 CAGTCAAAGCAAAAGTGGGTTGG + Intergenic
1108795392 13:54024029-54024051 CAGTCACAGTAGAGGGTGGCTGG - Intergenic
1109061901 13:57631388-57631410 CATTTAAAGGAGGAGGGGGGAGG - Intergenic
1109276866 13:60313319-60313341 CAGTCAAAGAAGAGGAGAGCGGG + Intergenic
1109489141 13:63072234-63072256 CAGTCAAAGAAAAAGTGGACTGG - Intergenic
1110220958 13:73072734-73072756 CGGTAAAAGGAAAAGGGAGCAGG - Intronic
1112646152 13:101334344-101334366 GAGTCACAGGAGATGGGGGTAGG + Intronic
1114258095 14:21019289-21019311 AAACCAAAGGAGAAAGGGGCAGG + Intronic
1114367878 14:22049578-22049600 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115823104 14:37233911-37233933 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1117224967 14:53647226-53647248 CAGTCAAAGGGGCAGGGGCTTGG - Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117662475 14:58021700-58021722 CAGCCAGAGGAGAAAGGGCCAGG + Intronic
1117689177 14:58287771-58287793 CAGTCAAAGCAAAAGCAGGCTGG - Intronic
1117733307 14:58745599-58745621 TACTCAAAGGAGAAAAGGGCAGG - Intergenic
1117733960 14:58751092-58751114 CAGCCAAGGCAGCAGGGGGCTGG - Intergenic
1117799381 14:59427675-59427697 CAGTCAGAGGATAATAGGGCTGG - Intergenic
1117933837 14:60878698-60878720 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1118005099 14:61558431-61558453 CAGTGAAAGCAGCAGGGGCCTGG - Intronic
1118735269 14:68696599-68696621 CAGTGAGAGGAGCAGAGGGCTGG - Intronic
1118830691 14:69428752-69428774 CAGTCAAAGCAGAAGTGGGTCGG + Intronic
1118851508 14:69587234-69587256 CAGCCATTTGAGAAGGGGGCTGG - Intergenic
1119231073 14:72980287-72980309 CTGTAAAAGGAGAAGTGTGCAGG + Intronic
1119335432 14:73829522-73829544 CAGCCACAGAAGAAAGGGGCGGG - Intergenic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1122885060 14:104707211-104707233 GGGTCAAGGGAGAAGGGAGCCGG - Intronic
1202918780 14_KI270723v1_random:11892-11914 CAGTCAAAGTGGATGGGGTCAGG - Intergenic
1202925856 14_KI270724v1_random:23162-23184 CAGTCAAAGTGGATGGGGTCAGG + Intergenic
1124490194 15:30150756-30150778 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1124518840 15:30393127-30393149 CAGTTGCAGGAGAAAGGGGCGGG + Intronic
1124753338 15:32387573-32387595 AAGTCACAGATGAAGGGGGCTGG - Intergenic
1124975081 15:34523273-34523295 AAGTCACAGATGAAGGGGGCTGG - Intergenic
1125065894 15:35486134-35486156 AAGGCAAAGGAGAAGCAGGCAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126006073 15:44258598-44258620 CAGTCAACTGAGAAGGGTGTAGG + Intergenic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129210504 15:74065318-74065340 AAGTCACAGATGAAGGGGGCTGG - Intergenic
1129403507 15:75300056-75300078 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1129627473 15:77217311-77217333 CATTCAAAGCAAAAGTGGGCTGG + Intronic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1129727705 15:77909953-77909975 AAGTCACAGATGAAGGGGGCTGG - Intergenic
1129840190 15:78739022-78739044 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1130258723 15:82337971-82337993 AAGTCACAGAAGAAGGGGGCTGG - Intergenic
1130269962 15:82441113-82441135 AAGTCACAGAAGAAGGGGGCTGG + Intergenic
1130462297 15:84168426-84168448 AAGTCACAGAAGAAGGGGGCTGG + Intergenic
1130473916 15:84247351-84247373 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1130481330 15:84361419-84361441 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1130490376 15:84426359-84426381 AAGTCACAGAAGAAGGGGGCTGG - Intergenic
1130501967 15:84505117-84505139 AAGTCACAGAAGAAGGGGGCTGG - Intergenic
1130596200 15:85251988-85252010 AAGTCACAGAAGAAGGGGGCTGG + Intergenic
1133141994 16:3751948-3751970 CAATGAAAGGAACAGGGGGCAGG + Intronic
1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG + Intronic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1133412667 16:5581120-5581142 GATCCAGAGGAGAAGGGGGCAGG + Intergenic
1133576220 16:7093406-7093428 GTGTCAAAGAAGAAGTGGGCTGG - Intronic
1133722078 16:8504105-8504127 CAGTCAAAGTAAAAGTGGACTGG - Intergenic
1133896953 16:9938824-9938846 GACTCAAAGGAGGAAGGGGCAGG - Intronic
1134432515 16:14224034-14224056 CAGTCACAGTAGAAGGGTGAAGG + Intronic
1135451850 16:22565351-22565373 CATTAAACGGAGATGGGGGCCGG + Intergenic
1135631607 16:24039855-24039877 AAGACCAAGGAGGAGGGGGCTGG - Intronic
1135857998 16:26029760-26029782 CAGTTCCAGGAGAAGGGTGCTGG + Intronic
1136936684 16:34474214-34474236 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1136947988 16:34678867-34678889 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136955377 16:34778745-34778767 AAGGCAAATGAGAAGAGGGCAGG + Intergenic
1136959102 16:34825251-34825273 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136963135 16:34874356-34874378 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136967226 16:34928559-34928581 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1137085017 16:36109295-36109317 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1137087838 16:36150670-36150692 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1137221551 16:46456776-46456798 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1139055527 16:63179074-63179096 GAGTGAAAGGAGAGGGGGGGGGG + Intergenic
1139114371 16:63931665-63931687 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1140025077 16:71280832-71280854 CAATAAAAGAATAAGGGGGCAGG + Intergenic
1140291467 16:73662839-73662861 CAAGCAAAGGGGAAGTGGGCGGG + Intergenic
1140332244 16:74069540-74069562 CAGGCATAGGAGTATGGGGCAGG + Intergenic
1140700946 16:77581077-77581099 CTGTCCAAGGAGAAGATGGCTGG + Intergenic
1140882043 16:79207226-79207248 GAGTCAATGGATAAGGTGGCTGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141253746 16:82382082-82382104 GAGTCCAAGGTGAAGGTGGCAGG + Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1142262390 16:89049072-89049094 AGGTCAAAGGAGAAGGGAGCGGG - Intergenic
1142455344 16:90218043-90218065 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
1142455360 16:90218114-90218136 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
1142455377 16:90218185-90218207 AGGTCAGAGGAGATGGGGGCTGG + Intergenic
1142455395 16:90218260-90218282 AGGTCAGAGGAGATGGGGGCTGG + Intergenic
1143122537 17:4617852-4617874 CAGTGAGGGGAGTAGGGGGCAGG - Intergenic
1143254629 17:5546520-5546542 CAGACAAAGGAGAAATTGGCGGG - Intronic
1144036592 17:11371371-11371393 GAGTCAAGGGAAAAGGGAGCTGG - Intronic
1144865131 17:18330756-18330778 CAGTCAAAGCAGATGAGGTCAGG + Intronic
1145324032 17:21783580-21783602 AAGACAAATGAGAAGGGGGCAGG - Intergenic
1145326580 17:21835215-21835237 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1145689559 17:26724381-26724403 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1145767938 17:27472163-27472185 CAGTCAGGGGAGAAAGGGTCAGG - Intronic
1145783230 17:27577650-27577672 CAGGCAAGGGAGAGGGTGGCAGG - Intronic
1145897888 17:28471139-28471161 TAATTAAAGGAGAAGGGGGTGGG + Intronic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146675189 17:34768435-34768457 CATTCAGAGGATAAGGGAGCTGG - Intergenic
1146768773 17:35548909-35548931 CATCCAAAGGCGAAGGGGACTGG - Exonic
1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG + Intronic
1148383901 17:47220935-47220957 CAGCCAGAGGAGAAGGGGGACGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149067121 17:52494156-52494178 AAGTCAAAGGAGAAAGGCACAGG - Intergenic
1149305681 17:55344542-55344564 CAGGCATAGTAGAAGGGGACAGG - Intergenic
1151456019 17:74226256-74226278 GAGTGAGAAGAGAAGGGGGCTGG + Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1203165393 17_GL000205v2_random:88663-88685 TAGTCTAAGGAGAAAGAGGCCGG - Intergenic
1203182830 17_KI270729v1_random:80349-80371 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1203190770 17_KI270729v1_random:185806-185828 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1154516438 18:15171967-15171989 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1155006346 18:21733011-21733033 CAGTCAAAGCAAAAGTGGACCGG - Intronic
1155096517 18:22560685-22560707 CAGCCAAAGGAGAAAGTGGAGGG - Intergenic
1156255280 18:35389473-35389495 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1156535783 18:37863261-37863283 AAGTCAAGGTAGAAGGAGGCAGG - Intergenic
1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG + Intergenic
1157090181 18:44627635-44627657 CAGTCTCAGGAGATGGGGCCTGG + Intergenic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159343136 18:67163147-67163169 CAGTCACAGCACAAGTGGGCTGG - Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160316648 18:77854078-77854100 CAGTCAACGGACAAGAGGGGTGG + Intergenic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1161693625 19:5752729-5752751 CATGGAAAGGAAAAGGGGGCCGG + Intronic
1161740685 19:6019177-6019199 TATTCAAAGGACAAGAGGGCGGG - Intronic
1162154248 19:8666005-8666027 GAATCAAAGGAGAAGGGAGGAGG - Intergenic
1162275456 19:9650478-9650500 ATGTGAAAAGAGAAGGGGGCGGG + Intronic
1162753147 19:12841035-12841057 GAGGCAAACGAGAAGTGGGCGGG - Exonic
1163325920 19:16603194-16603216 CAGCCAAAGAAGAGAGGGGCTGG + Intronic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1166604337 19:44127120-44127142 CAGCCAGAGGAGCAGGGGGTGGG - Intronic
1166822028 19:45586461-45586483 CTGTAAAATGGGAAGGGGGCTGG - Intronic
1166894833 19:46016766-46016788 CAGTCAAGGCAGCAGGGGGCTGG - Exonic
1168315495 19:55483173-55483195 CAGCCAGTGGAGCAGGGGGCTGG - Exonic
1168565532 19:57419175-57419197 CAGTAAAAGGAACAGGTGGCTGG - Intronic
926083331 2:10006247-10006269 CAGTAAGAGGTGAAGCGGGCTGG - Intergenic
926355686 2:12038864-12038886 CTGTAAAAGGAGAAGGGTCCAGG + Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
927057749 2:19382679-19382701 CAGTCAAAGTAAAAGTGGACTGG - Intergenic
927194059 2:20535698-20535720 CCAACACAGGAGAAGGGGGCAGG + Intergenic
927343061 2:22004310-22004332 CAGTCAAATGCGCAGAGGGCAGG + Intergenic
927756989 2:25716635-25716657 CAGGCAGAGGAGAAAGGGCCTGG - Intergenic
927997122 2:27494443-27494465 CATTCACAGGAGAGGGAGGCCGG + Exonic
928224073 2:29432378-29432400 CAGTCATAGCAGAAGGGGCGGGG - Intronic
928893144 2:36229337-36229359 AAGTCAAAGAATAAGGTGGCAGG + Intergenic
929042763 2:37761443-37761465 ATGTCAAAAGAGATGGGGGCAGG - Intergenic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
930233373 2:48865307-48865329 CAGTCAAAGGAGAGGCTGGAGGG + Intergenic
930632552 2:53769544-53769566 CTTTAAAAGGAGAAAGGGGCTGG + Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931759325 2:65402587-65402609 GAGGGAAAGGAGAAGGGGGTAGG + Intronic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
934252286 2:90367622-90367644 AAGACAAATGAGAAGAGGGCAGG - Intergenic
934257156 2:91435323-91435345 AAGACAAATGAGAAGAGGGCAGG + Intergenic
934557566 2:95295518-95295540 CAGTGAAAGGAGGATGGGGCTGG + Intergenic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
934882302 2:97995258-97995280 CAGTGACAGGAGACGGGGGAAGG + Intronic
935064186 2:99633768-99633790 AGGTCAGAGGAGAAGTGGGCAGG - Intronic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
937480105 2:122249378-122249400 CAGTCAGAAGAGAAGTGGGTAGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG + Intergenic
938516759 2:132016961-132016983 AAGACAAATGAGAAGAGGGCAGG - Intergenic
938573771 2:132585464-132585486 CAGTCACGGGAGAAGCGGGGAGG - Intronic
938631090 2:133168534-133168556 CAGGCAAAGCGGAAGGGAGCTGG - Intronic
939059825 2:137408315-137408337 AAGATAAAGGAGAAGGGGGAAGG - Intronic
939500135 2:142974230-142974252 CAGTAAAGGGAAAAGTGGGCTGG + Intronic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
941652963 2:168113085-168113107 TAGACAATGGAGAAGAGGGCTGG - Intronic
941866184 2:170337068-170337090 CAGTCAAAGGTGATGGTGTCAGG + Intronic
942300561 2:174557249-174557271 AAGACAAAGGAGAAGGGAACTGG + Intergenic
943249754 2:185503747-185503769 CAGTCAAAGTATAAGTGGACTGG - Intergenic
943357501 2:186875520-186875542 CAGTCAAAGCACAAGGGGACTGG - Intergenic
944485608 2:200201966-200201988 CAGTGAAAGGAGATAGGGGTGGG + Intergenic
944853613 2:203744848-203744870 CAGTCATGGCAGAAGGGGGAAGG - Intergenic
945006862 2:205417741-205417763 CAGTGAAAGGTTAAGGGGGCTGG - Intronic
945233660 2:207614515-207614537 CAGCCTAAGGAGAAGTGGACTGG - Intronic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945824801 2:214708552-214708574 CCCTCAAAGGGTAAGGGGGCAGG + Intergenic
946149366 2:217753769-217753791 CAGTAACTGGAGAAGGGGGCAGG + Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946689600 2:222300376-222300398 CTGTCAAAGGAGGTGGGGGAGGG - Intronic
947992935 2:234501056-234501078 CTGTAAATGGAGAATGGGGCTGG + Intergenic
948029057 2:234801421-234801443 CAGTTTGAGGAGAAGGGAGCAGG - Intergenic
948504283 2:238417799-238417821 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504294 2:238417841-238417863 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504316 2:238417925-238417947 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504338 2:238418009-238418031 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504349 2:238418051-238418073 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504360 2:238418093-238418115 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504371 2:238418135-238418157 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504382 2:238418177-238418199 CACACACAGGAGAAGGGCGCAGG - Intergenic
948504392 2:238418219-238418241 CACACACAGGAGAAGGGCGCAGG - Intergenic
948504402 2:238418261-238418283 CACACACAGGAGAAGGGCGCAGG - Intergenic
948990732 2:241552596-241552618 GAGACACAGGAGACGGGGGCGGG - Intergenic
948993355 2:241565429-241565451 TGGACAAAGGTGAAGGGGGCTGG - Intronic
949086825 2:242162769-242162791 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
949086842 2:242162840-242162862 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
949086859 2:242162911-242162933 AGGTCAGAGGAGATGGGGGCTGG + Intergenic
949086875 2:242162982-242163004 AGGTCAGAGGAGATGGGGGCCGG + Intergenic
949086894 2:242163057-242163079 AGGTCAGAGGAGATGGGGGCTGG + Intergenic
1168908126 20:1423200-1423222 TAGTCAAAGGGGATGGGGTCTGG + Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170462065 20:16586677-16586699 CAGCCAAAGGAGAAGGTGAAGGG + Intergenic
1170857553 20:20071116-20071138 CAGTTAAAAGTGAAGGGAGCTGG + Intronic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1173289759 20:41704204-41704226 CAGTGAATGGAGAAGGGGATGGG - Intergenic
1173375422 20:42478203-42478225 GGGTGAAAGGAGAAGGGGGAAGG + Intronic
1173547996 20:43914340-43914362 CAGTGAGACGAGGAGGGGGCGGG + Intergenic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1174814835 20:53677829-53677851 CAATCAAAGGGGGAGGGGGCAGG - Intergenic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1175802472 20:61808785-61808807 CAGTCAAAGGTGGAGGGGGCAGG - Intronic
1175985318 20:62761530-62761552 CAGTCCCAGGAGAAGCTGGCCGG + Exonic
1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176391461 21:6218160-6218182 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG + Intergenic
1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176507123 21:7658591-7658613 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1176973407 21:15290685-15290707 CTGTCAACTGAGAAGGGGGTGGG + Intergenic
1177683899 21:24411594-24411616 CAGTGACAGGACAAAGGGGCAGG - Intergenic
1178074928 21:29006094-29006116 CAGGTAAGGGAGAAGGGGGTTGG + Exonic
1179213835 21:39349316-39349338 CAGACCCAGGCGAAGGGGGCGGG + Intronic
1179434277 21:41349673-41349695 GAGGTAGAGGAGAAGGGGGCTGG + Intronic
1179557386 21:42188521-42188543 TAGCCCAGGGAGAAGGGGGCTGG + Intergenic
1179723317 21:43328314-43328336 CAATCCCTGGAGAAGGGGGCTGG + Intergenic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1182046229 22:27276255-27276277 CAGTCATAGCAGAAGGGGAAGGG - Intergenic
1182246868 22:28965064-28965086 CTGTCAAAAGAGAAGGGAGCAGG + Intronic
1183169630 22:36177510-36177532 TAGTCCAGGGAAAAGGGGGCAGG - Intergenic
1184175730 22:42787826-42787848 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
1203294947 22_KI270736v1_random:32932-32954 ATGTCAAAAGAGATGGGGGCAGG - Intergenic
1203325638 22_KI270738v1_random:13100-13122 AAGACAAATGAGAAGAGGGCAGG - Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
950405842 3:12803985-12804007 CACTCAAAGGGTAAGGGAGCTGG + Intronic
950727147 3:14923827-14923849 CAGACAAAGGCTATGGGGGCTGG - Intronic
951117943 3:18887165-18887187 CAGTCAAAGCAGAAGTTGGGGGG - Intergenic
951297447 3:20956212-20956234 CAGTCAAAGCAGAAGCAGACAGG + Intergenic
951963217 3:28352070-28352092 GAGACAAAGGAGACGGGGGAAGG - Intronic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
954634592 3:52064695-52064717 CAGGCAGAGGAGAAGGGGAAAGG + Intergenic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
955129093 3:56145988-56146010 CACTCAAAGTAGAATTGGGCTGG + Intronic
955170403 3:56558154-56558176 CAGTCAAGGGAGAGAGAGGCTGG - Intronic
955238084 3:57157380-57157402 AAGACAAAGGAGTAGGGGCCTGG - Intronic
956923613 3:73957714-73957736 CAGTCAAAGCAAAAGTGAGCTGG + Intergenic
957082735 3:75650327-75650349 CAGTCAAAGTGGATGGGGTCAGG + Intergenic
957734387 3:84187912-84187934 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
957758335 3:84522393-84522415 CAGTGATATGAGACGGGGGCGGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961491767 3:127261351-127261373 AAGTCACAGGGGAAGGAGGCAGG - Intergenic
961623058 3:128239847-128239869 CAGTCACAGGAGAAGGCTCCAGG - Intronic
961958081 3:130824877-130824899 CAGTCAAGGGGCAAGGGAGCTGG - Intergenic
962106640 3:132396614-132396636 CAGTGAAAGGTGAAGCCGGCTGG + Intergenic
963538012 3:146552384-146552406 CACTTAATGGAGAAGGAGGCTGG + Intergenic
963692761 3:148525435-148525457 CAGTGAAAGGTGAAGCTGGCTGG + Intergenic
963791163 3:149583797-149583819 CAGTCAAATGAGCAGGGAGAAGG + Intronic
965070008 3:163907814-163907836 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
965625213 3:170677952-170677974 CAGTGAAAGGAGACAGGGGTGGG + Intronic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
966941180 3:184748409-184748431 GAGTGAAAAGAGAAGGGGTCAGG - Intergenic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
967465286 3:189798016-189798038 CAGTCAAAGGATAGGGAGGAAGG - Intronic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968808600 4:2790160-2790182 AAGGCCAAAGAGAAGGGGGCCGG - Intergenic
969150156 4:5162463-5162485 GAGTCAGTGGAGAAGGTGGCTGG - Intronic
969608981 4:8216652-8216674 CAGTCCATGGAGAAGGGCCCTGG + Intronic
970564165 4:17315143-17315165 CAATCAAATGGGAAGGGGGAGGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
971860292 4:32093127-32093149 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
971919800 4:32923107-32923129 AAGACAAAGGAGCAGGTGGCTGG - Intergenic
974115800 4:57577933-57577955 CAGGCAAAGGAGCAGGGTTCTGG - Intergenic
976210941 4:82669095-82669117 CAGTCAAGGGAGATGGAGTCAGG + Intronic
976841963 4:89442205-89442227 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
977900241 4:102414122-102414144 CAAGCAAAAGAGGAGGGGGCAGG - Intronic
978219794 4:106256402-106256424 GAGTCAAGGCAGCAGGGGGCTGG + Intronic
981292975 4:143097907-143097929 CACGCAAAGGGGAAGAGGGCAGG - Intergenic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
982277139 4:153647561-153647583 CACTCAAGGGGGAAGGAGGCTGG + Intergenic
982490326 4:156021724-156021746 CAGCCAAAGGAGATGGGGTGAGG - Intergenic
983235233 4:165171780-165171802 CAGTCAAAGCAGTAGTGGGTGGG + Intronic
984217059 4:176926579-176926601 CAGTGAGAGGAAAAGAGGGCCGG + Intergenic
984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG + Intergenic
984451678 4:179911330-179911352 GAGTCAGAGGACAAGGGGACAGG - Intergenic
985278757 4:188266625-188266647 GAGTCAGAGGTGAAGGGGGATGG - Intergenic
985873783 5:2579546-2579568 TAGTCAAAGGATATAGGGGCAGG - Intergenic
985955517 5:3262691-3262713 CAGTCAGAGGAGCTGTGGGCCGG + Intergenic
986387521 5:7249041-7249063 AAGGCAGAGGAGAAGGCGGCTGG + Intergenic
987011787 5:13773854-13773876 CAGACAAAGGAGGAGTGGGTGGG + Intronic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
990723099 5:58720596-58720618 AAGTCAAAAGAAATGGGGGCTGG - Intronic
990786029 5:59420879-59420901 CAGTCAGGGTAGCAGGGGGCAGG + Intronic
992080436 5:73231016-73231038 TAGACAATTGAGAAGGGGGCTGG - Intergenic
992384423 5:76270044-76270066 GAGACAAAGGAGAAAGGGGATGG + Intronic
994354519 5:98779982-98780004 CATGCAAAGTAGAAGGGGCCTGG + Exonic
994703344 5:103166125-103166147 CAGTCAAAGCAGAAGCAGACTGG + Intronic
995577823 5:113559880-113559902 CAGTCAAAGCAAAAGCGGACTGG + Intronic
995742362 5:115368638-115368660 GAGCCAAGGAAGAAGGGGGCTGG - Intergenic
995833251 5:116376514-116376536 GATTCAAGGGAGCAGGGGGCAGG + Intronic
996337033 5:122395663-122395685 CACACAAAACAGAAGGGGGCAGG - Intronic
997365057 5:133320319-133320341 CAGTGAAACCAGCAGGGGGCAGG - Intronic
998216780 5:140243469-140243491 CAATCAGAAGAGATGGGGGCAGG - Exonic
998359633 5:141573803-141573825 CAGGCAAAGGAGGAGGTGGGGGG + Exonic
998548289 5:143050892-143050914 CAGGCAAAGGTGATGGTGGCTGG - Intronic
998947482 5:147355322-147355344 CAGACAAAGGAGAAGAGAGAAGG - Intronic
999717319 5:154371742-154371764 CAATGCAAGGAGAATGGGGCAGG - Intronic
1000632191 5:163603250-163603272 CAGTCAAGGGGGAAGGATGCTGG + Intergenic
1001773400 5:174311972-174311994 CAGTCAAAGGAGGGAAGGGCTGG + Intergenic
1001845668 5:174918491-174918513 AAGTCACAGATGAAGGGGGCTGG - Intergenic
1002058533 5:176612465-176612487 CAGTCAGTGGAGAAGCGGGGTGG + Intergenic
1002185590 5:177453455-177453477 CAGGCCCAGGAGAAGGGGACTGG + Intronic
1004001717 6:11602459-11602481 AAGTTAAAGGAGAAAGGGACAGG - Intergenic
1004100082 6:12600473-12600495 CAATAAAAAGGGAAGGGGGCCGG + Intergenic
1004553845 6:16675938-16675960 CTGCCAAAGGAGAAGCGGACAGG + Intronic
1004574899 6:16886263-16886285 CAGTGAAGGGAGATGGGGGTGGG - Intergenic
1004603515 6:17173423-17173445 CAGGCAAGGGAGAAGGGGAAGGG + Intergenic
1006265765 6:32921892-32921914 ATGTCAATGGAGATGGGGGCGGG + Intergenic
1006307451 6:33232339-33232361 CAGTCAAAGGCGGAGTGAGCCGG + Intergenic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007711729 6:43828352-43828374 CAGCCAATGGGGCAGGGGGCAGG + Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1009768333 6:68111305-68111327 CAGTCAAAAGAGAAATGAGCCGG - Intergenic
1012342337 6:98142841-98142863 CAGTCAAAGGGGCCGGGGTCAGG - Intergenic
1013067807 6:106700458-106700480 CATTCAAGGGAGAAGGGCGAGGG - Intergenic
1013379084 6:109548910-109548932 CAGTCAAAGCAAAAGTGGACTGG + Intronic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1015434968 6:133174737-133174759 AAGACAAAGGAGAAGGGGAAGGG - Intergenic
1015850554 6:137567620-137567642 AAGTCAAAGAAGGAGAGGGCTGG - Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1018935377 6:168270794-168270816 CACTCAGAGGAGCCGGGGGCAGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020784583 7:12557403-12557425 CAGTCAATGGAGAAAGGGTACGG - Intergenic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023225144 7:37961293-37961315 CAGTAAAAGCAGGAGGTGGCTGG - Intronic
1023485087 7:40677721-40677743 CAGTCAAAAGAGAATGGGGTTGG + Intronic
1023835682 7:44065955-44065977 CAATCACAGGAGAAAGGGGTTGG - Intronic
1024549618 7:50551527-50551549 TAGTCAAAGTACAATGGGGCCGG - Intronic
1024807171 7:53156397-53156419 AAGACAAATGAGAAGAGGGCGGG - Intergenic
1025319516 7:58079792-58079814 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1025489153 7:61090255-61090277 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1025554199 7:62283679-62283701 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1025560582 7:62369595-62369617 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1026107897 7:67435444-67435466 CAGTCAAAGGGGAAGTGAGCAGG + Intergenic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1028174144 7:87634015-87634037 GAGTCAAAGGGGAAGCAGGCAGG + Intronic
1028750595 7:94378143-94378165 AAGTCAAAGGAGGAGAGGGAAGG + Intergenic
1030106404 7:105990901-105990923 CAATCAAGGGTGAATGGGGCAGG + Intronic
1030441978 7:109597290-109597312 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
1030616858 7:111746295-111746317 CAGGCAAAATAGAAGGGGGTTGG + Intronic
1031769362 7:125823721-125823743 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1031777926 7:125923989-125924011 CAGTGAAGGGAGAAAGGGGTGGG - Intergenic
1032522733 7:132558737-132558759 CAGGCAAAGGCGAAAGAGGCGGG - Intronic
1032723337 7:134568610-134568632 CAGTCACAGGCCAAGGGTGCAGG + Intronic
1033378744 7:140791236-140791258 CAGTAAGAGGAGAAGGCAGCAGG - Intronic
1033790850 7:144790905-144790927 CAATCAAGGGTGAAGGGGGTGGG + Intronic
1033896208 7:146073899-146073921 CAGTAATACGGGAAGGGGGCAGG + Intergenic
1033909823 7:146248915-146248937 CAGTGAAGGGAGAAAGGGGTGGG + Intronic
1034257492 7:149732671-149732693 GAGTAAAAGCAGAAGGGGGTGGG + Intronic
1034541195 7:151759333-151759355 CAGTCAAAGGAGAGGGGCTGCGG - Intronic
1035162513 7:156961374-156961396 CAGTCTGAAGAGGAGGGGGCTGG + Intronic
1035497832 8:68283-68305 AGGTCAGAGGAGATGGGGGCTGG - Intergenic
1035497850 8:68358-68380 AGGTCAGAGGAGATGGGGGCTGG - Intergenic
1035497867 8:68429-68451 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
1035497884 8:68500-68522 AGGTCAGAGGAGATGGGGGCCGG - Intergenic
1036079564 8:5540315-5540337 AAGTCAAAGGAGGATAGGGCAGG + Intergenic
1036719100 8:11156152-11156174 CAGTAAAAGGTGAAGAGGGAAGG - Intronic
1036722040 8:11185089-11185111 CAGTCTAAGGACATGGGTGCGGG + Intronic
1037769141 8:21788930-21788952 CCGCGAAGGGAGAAGGGGGCGGG - Intronic
1038310545 8:26443118-26443140 CACTGAAAGGAGAAAGGGGGAGG + Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1039434020 8:37547297-37547319 CAAGCCAAGGAGGAGGGGGCTGG - Intergenic
1039510942 8:38091351-38091373 CAGTCACAGGAGCAGCGTGCAGG - Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1042033140 8:64499385-64499407 CAGTCAAAGGGGAATGGGAGAGG + Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043509374 8:80934258-80934280 CAGTCACAGGAGAAGGTGATAGG - Intergenic
1044590818 8:93913149-93913171 CAGTCACAGGGGAAAGAGGCTGG - Intronic
1045237619 8:100368311-100368333 CAGTCAAAGCAAAAAGGGACTGG + Intronic
1047958555 8:129994326-129994348 CAGTCCAAGGCGAAGGTGCCGGG - Intronic
1048764568 8:137830268-137830290 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1050252332 9:3758001-3758023 TAGACAAAGGAAAAGGGGGTTGG - Intergenic
1050351699 9:4746018-4746040 CAGTTAAAGGTGGAGGGGACAGG - Intergenic
1050906285 9:11011165-11011187 AAGTCAAAGGAGAAAGGGCAAGG + Intergenic
1051715299 9:19976480-19976502 CAGTCACAGTAGAAGGTGGAGGG - Intergenic
1051796446 9:20876855-20876877 AATTAAAAGGAGAAAGGGGCAGG - Intronic
1053467125 9:38316701-38316723 CTGTCAGAGGATAAGGAGGCAGG + Intergenic
1056786549 9:89596759-89596781 CAGTCACAAGGGAAGGGGTCTGG - Intergenic
1056999638 9:91495719-91495741 CTCTCAAGGGAGAAGGGGACTGG + Intergenic
1057958553 9:99432945-99432967 CACCCAAAGCAGAAGGGGGGTGG - Intergenic
1058573651 9:106376146-106376168 CAGTCAAAGGATGAATGGGCTGG - Intergenic
1059385328 9:113959903-113959925 CGTTTAAAGGAGAAGGGGGCCGG - Intronic
1060813088 9:126620882-126620904 CAGCCAATGGAGAAGGGGGTAGG + Intronic
1060879967 9:127111195-127111217 CAAACAACGAAGAAGGGGGCAGG - Intronic
1061061937 9:128254805-128254827 AAGTCACAGATGAAGGGGGCTGG - Exonic
1061504770 9:131025565-131025587 CAGGCAAAGGAGAGGAGAGCAGG + Intronic
1061507196 9:131038101-131038123 CAGGCAGAGGAAGAGGGGGCGGG - Intronic
1062240723 9:135536377-135536399 GACTGCAAGGAGAAGGGGGCGGG - Intergenic
1062338871 9:136084703-136084725 CAGTCAAAGGAAATGGCGGCGGG + Intronic
1062483857 9:136764626-136764648 CAAACAATGGACAAGGGGGCCGG - Intronic
1062532228 9:137007018-137007040 AAGGCTAAGGGGAAGGGGGCCGG + Intergenic
1203425349 Un_GL000195v1:32114-32136 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1203442790 Un_GL000219v1:27069-27091 CAGTCAAAGTGGATGGGGTCGGG - Intergenic
1203513598 Un_KI270741v1:145978-146000 CAGTCAAAGTGGATGGGGTCGGG - Intergenic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1190988656 X:55522926-55522948 CAGCCAAGGGAGGAGGGTGCAGG + Intergenic
1191846213 X:65549977-65549999 CAGACACAGGAGGAGAGGGCAGG + Intergenic
1192581872 X:72289873-72289895 AATTTAAAGGAGGAGGGGGCCGG - Intronic
1193494265 X:82191014-82191036 CAGTCAAATTTGAAGAGGGCCGG + Intergenic
1194220764 X:91187447-91187469 CAGTCAAAGCAAAAGTGGACAGG + Intergenic
1196835533 X:119810467-119810489 CAGTCAAAGCAAAAGTGGTCTGG + Intergenic
1198520667 X:137449246-137449268 CAGTGAAAGGAAAAGGGAGAAGG - Intergenic
1198882485 X:141296020-141296042 CAGTCAAAGCAGCTGGGAGCGGG - Intergenic
1200942641 Y:8801665-8801687 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
1201319251 Y:12679346-12679368 CAATCAAATGAGAATGGGGGAGG - Intergenic
1202367850 Y:24179203-24179225 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1202376990 Y:24246705-24246727 AAGTCACAGATGAAGGGGGCTGG - Intergenic
1202493790 Y:25423416-25423438 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1202502933 Y:25490914-25490936 AAGTCACAGATGAAGGGGGCTGG - Intergenic