ID: 1007739577

View in Genome Browser
Species Human (GRCh38)
Location 6:44002498-44002520
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007739577 Original CRISPR GAGCCCTGACATCGATTCTG CGG (reversed) Intronic