ID: 1007743734

View in Genome Browser
Species Human (GRCh38)
Location 6:44029490-44029512
Sequence GGTTCTAGGGAGGGGAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007743723_1007743734 -1 Left 1007743723 6:44029468-44029490 CCCTCCAAGTCTGAGGATCGCTG No data
Right 1007743734 6:44029490-44029512 GGTTCTAGGGAGGGGAGGGCAGG No data
1007743719_1007743734 29 Left 1007743719 6:44029438-44029460 CCTTTGCTTCTAGCACAGTTTGG No data
Right 1007743734 6:44029490-44029512 GGTTCTAGGGAGGGGAGGGCAGG No data
1007743726_1007743734 -5 Left 1007743726 6:44029472-44029494 CCAAGTCTGAGGATCGCTGGTTC No data
Right 1007743734 6:44029490-44029512 GGTTCTAGGGAGGGGAGGGCAGG No data
1007743724_1007743734 -2 Left 1007743724 6:44029469-44029491 CCTCCAAGTCTGAGGATCGCTGG No data
Right 1007743734 6:44029490-44029512 GGTTCTAGGGAGGGGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007743734 Original CRISPR GGTTCTAGGGAGGGGAGGGC AGG Intergenic
No off target data available for this crispr